ID: 1000291798

View in Genome Browser
Species Human (GRCh38)
Location 5:159877741-159877763
Sequence GAATCCAAAGCTCAGAAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000291797_1000291798 -7 Left 1000291797 5:159877725-159877747 CCACTTTATAAGTAAGGAATCCA No data
Right 1000291798 5:159877741-159877763 GAATCCAAAGCTCAGAAAGAAGG No data
1000291791_1000291798 19 Left 1000291791 5:159877699-159877721 CCATAAGGTAGGTACTGTCCCTA No data
Right 1000291798 5:159877741-159877763 GAATCCAAAGCTCAGAAAGAAGG No data
1000291795_1000291798 -5 Left 1000291795 5:159877723-159877745 CCCCACTTTATAAGTAAGGAATC No data
Right 1000291798 5:159877741-159877763 GAATCCAAAGCTCAGAAAGAAGG No data
1000291796_1000291798 -6 Left 1000291796 5:159877724-159877746 CCCACTTTATAAGTAAGGAATCC No data
Right 1000291798 5:159877741-159877763 GAATCCAAAGCTCAGAAAGAAGG No data
1000291790_1000291798 20 Left 1000291790 5:159877698-159877720 CCCATAAGGTAGGTACTGTCCCT No data
Right 1000291798 5:159877741-159877763 GAATCCAAAGCTCAGAAAGAAGG No data
1000291793_1000291798 0 Left 1000291793 5:159877718-159877740 CCTAACCCCACTTTATAAGTAAG No data
Right 1000291798 5:159877741-159877763 GAATCCAAAGCTCAGAAAGAAGG No data
1000291789_1000291798 21 Left 1000291789 5:159877697-159877719 CCCCATAAGGTAGGTACTGTCCC No data
Right 1000291798 5:159877741-159877763 GAATCCAAAGCTCAGAAAGAAGG No data
1000291792_1000291798 1 Left 1000291792 5:159877717-159877739 CCCTAACCCCACTTTATAAGTAA No data
Right 1000291798 5:159877741-159877763 GAATCCAAAGCTCAGAAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000291798 Original CRISPR GAATCCAAAGCTCAGAAAGA AGG Intergenic