ID: 1000293293

View in Genome Browser
Species Human (GRCh38)
Location 5:159891063-159891085
Sequence CATAGCTACCATCTTAGAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000293293_1000293298 4 Left 1000293293 5:159891063-159891085 CCCCCTCTAAGATGGTAGCTATG No data
Right 1000293298 5:159891090-159891112 GTGAGTTCCAGATGGTCTTCTGG No data
1000293293_1000293297 -4 Left 1000293293 5:159891063-159891085 CCCCCTCTAAGATGGTAGCTATG No data
Right 1000293297 5:159891082-159891104 TATGCTCAGTGAGTTCCAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000293293 Original CRISPR CATAGCTACCATCTTAGAGG GGG (reversed) Intergenic
No off target data available for this crispr