ID: 1000295283

View in Genome Browser
Species Human (GRCh38)
Location 5:159908287-159908309
Sequence TACCGTTAGCTCCAATTTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000295283_1000295284 -8 Left 1000295283 5:159908287-159908309 CCTGTAAATTGGAGCTAACGGTA No data
Right 1000295284 5:159908302-159908324 TAACGGTATCAACCACGCTATGG No data
1000295283_1000295287 12 Left 1000295283 5:159908287-159908309 CCTGTAAATTGGAGCTAACGGTA No data
Right 1000295287 5:159908322-159908344 TGGTTTGAATATGGTTTATTTGG No data
1000295283_1000295285 3 Left 1000295283 5:159908287-159908309 CCTGTAAATTGGAGCTAACGGTA No data
Right 1000295285 5:159908313-159908335 ACCACGCTATGGTTTGAATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000295283 Original CRISPR TACCGTTAGCTCCAATTTAC AGG (reversed) Intergenic