ID: 1000295284

View in Genome Browser
Species Human (GRCh38)
Location 5:159908302-159908324
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000295283_1000295284 -8 Left 1000295283 5:159908287-159908309 CCTGTAAATTGGAGCTAACGGTA No data
Right 1000295284 5:159908302-159908324 TAACGGTATCAACCACGCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000295284 Original CRISPR TAACGGTATCAACCACGCTA TGG Intergenic