ID: 1000295287 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 5:159908322-159908344 |
| Sequence | TGGTTTGAATATGGTTTATT TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1000295283_1000295287 | 12 | Left | 1000295283 | 5:159908287-159908309 | CCTGTAAATTGGAGCTAACGGTA | No data | ||
| Right | 1000295287 | 5:159908322-159908344 | TGGTTTGAATATGGTTTATTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1000295287 | Original CRISPR | TGGTTTGAATATGGTTTATT TGG | Intergenic | ||