ID: 1000298975

View in Genome Browser
Species Human (GRCh38)
Location 5:159937960-159937982
Sequence GGGAAGCTTTGGCCTCCAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 151}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000298975_1000298980 -2 Left 1000298975 5:159937960-159937982 CCCACTGGAGGCCAAAGCTTCCC 0: 1
1: 0
2: 1
3: 15
4: 151
Right 1000298980 5:159937981-159938003 CCACACCTCAGTGCTCTCCTAGG 0: 1
1: 2
2: 6
3: 25
4: 286

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000298975 Original CRISPR GGGAAGCTTTGGCCTCCAGT GGG (reversed) Intronic
901946940 1:12711811-12711833 GGGAATTTCTGGCCTGCAGTAGG + Intergenic
902563619 1:17295403-17295425 GAGGAGGTCTGGCCTCCAGTGGG + Intergenic
902730991 1:18368762-18368784 TGGAAGCTCTGGCTTCCAGCGGG + Intronic
902957289 1:19934235-19934257 GGGAGGCTTGTCCCTCCAGTAGG + Intergenic
905410118 1:37762823-37762845 GGGAGGCTTTGGAATCCAGGAGG + Exonic
906703358 1:47876065-47876087 GGGAGGCTGGGACCTCCAGTGGG - Intronic
911365898 1:96936955-96936977 GGGAAGCATTGGCCTTCCCTAGG + Intergenic
916664046 1:166949199-166949221 GGGATGCTGTGGCATCTAGTGGG - Intronic
917145070 1:171881730-171881752 AAGCACCTTTGGCCTCCAGTGGG + Intronic
921261008 1:213385036-213385058 GGGAAGTTTTGGAATCCAGGTGG - Intergenic
921350554 1:214230278-214230300 GGAAAACTTTGGCTTGCAGTGGG - Intergenic
921625602 1:217374797-217374819 GGGAAGGTGTGGACTCCAGGTGG - Intergenic
922561852 1:226575362-226575384 GGGAACCTTCAGCCTCCAGCTGG - Intronic
924569591 1:245226165-245226187 GGGAAGATCTGGAATCCAGTGGG + Intronic
1065179057 10:23106752-23106774 GAGAAGCCATGGCCTCCACTAGG - Intronic
1067448789 10:46368766-46368788 GGGAAGCTTTGGTCTCAGGGGGG + Intergenic
1067588583 10:47491999-47492021 GGGAAGCTTTGGTCTCAGGGGGG - Intergenic
1067635709 10:48000090-48000112 GGGAAGCTTTGGTCTCAGGGGGG - Intergenic
1070132269 10:73664097-73664119 GGGAAGCTTTGGTCTCAGGGGGG - Intergenic
1071571192 10:86698384-86698406 GGGGCCCTTTGGCCACCAGTGGG + Intronic
1072913234 10:99521782-99521804 TGGAAACCTTGGCCTCCAGCGGG - Intergenic
1073452944 10:103620194-103620216 GGGAGGCTGTGAGCTCCAGTGGG + Intronic
1075638937 10:124050526-124050548 GGGGTGCTATGGCATCCAGTGGG - Intronic
1075996106 10:126877571-126877593 GGGAAGCTCCTGCCACCAGTAGG - Intergenic
1076077605 10:127548095-127548117 GGGCAGCTTTGTCCTCCAAAAGG + Intergenic
1077402662 11:2366842-2366864 GCCAAGCCTGGGCCTCCAGTGGG - Intergenic
1077414836 11:2420176-2420198 GGGAAGCCTTGGGACCCAGTGGG - Intronic
1077706646 11:4493206-4493228 TGGATGCTGTGGCCTCCAGATGG + Intergenic
1078069918 11:8101723-8101745 ATGAAGCTTTGGCCCTCAGTGGG + Exonic
1080860860 11:36149147-36149169 GGGGAGCTTTGAACTCCATTTGG + Intronic
1083373540 11:62201540-62201562 GGGCATCTTTGTCCTCCAGGTGG - Intergenic
1084781305 11:71411230-71411252 GGAAGGCTTTTGCCTCCAATGGG + Intergenic
1085442106 11:76574792-76574814 GGCAAACTTTGGCTTCCACTGGG - Intergenic
1088448621 11:109958991-109959013 GGGAAGCTCCAGCCTCCAGAAGG + Intergenic
1091779425 12:3204595-3204617 GGGAATCTGGGGCCTCCAGGAGG + Intronic
1092242458 12:6843565-6843587 GGGAACCCTGGGCTTCCAGTGGG + Intronic
1095710796 12:45285893-45285915 GGGAAACTCAGACCTCCAGTGGG - Intronic
1096747491 12:53738370-53738392 GGGAATCTTTGGCTTCCATGTGG + Intergenic
1099931089 12:89075910-89075932 GGTAAATTTTGGCCTGCAGTTGG + Intergenic
1100283224 12:93138484-93138506 GGGTAGCTGTGGCTTCCACTCGG + Intergenic
1103724094 12:122989364-122989386 GGGAAGCCTGGGCCTCCAGATGG + Intronic
1106249417 13:27972292-27972314 GGGAAGCTTGGGCCTGCGGTTGG + Intergenic
1108519359 13:51232595-51232617 GGCAACATTTGGTCTCCAGTTGG - Intronic
1108688117 13:52838493-52838515 GGGAAGGCTTGACCTTCAGTGGG + Intergenic
1114392583 14:22326111-22326133 GAGCAGCTTTTGCCACCAGTAGG - Intergenic
1118620259 14:67608543-67608565 GGGAGGCTTAGGGCTTCAGTGGG + Intergenic
1119727915 14:76933274-76933296 GGGATGCCTTGGCCTTCAGAGGG + Intergenic
1122018009 14:98813277-98813299 GGCAGGCTCTGGCCTCTAGTTGG - Intergenic
1122621275 14:103058593-103058615 TGGAAGCGGTGGCCTCCAGGTGG + Intergenic
1123931016 15:25171693-25171715 GGGAAGGGGTGACCTCCAGTGGG - Intergenic
1128074900 15:64819943-64819965 GGGAAGCTGTGGCCTGGAGCTGG + Exonic
1132365673 15:101254551-101254573 GGACAGCCTTGGCCTCCAGGGGG - Intergenic
1134303989 16:13015713-13015735 GGAAACCTTTGATCTCCAGTAGG - Intronic
1136779277 16:32886530-32886552 GGGAAGCTCTAGCCCCCAGTGGG - Intergenic
1136891340 16:33974988-33975010 GGGAAGCTCTAGCCCCCAGTGGG + Intergenic
1137522538 16:49207086-49207108 GGGAAGCTTTAGGATCCAGCTGG + Intergenic
1142306856 16:89290568-89290590 GGGAGGCTCAGGGCTCCAGTGGG + Intronic
1142356954 16:89605807-89605829 GGGATGCGTGGGCCTCCGGTGGG + Intergenic
1142376023 16:89707550-89707572 GGGAAGCTTTGGGCTTCGGTGGG - Exonic
1203081693 16_KI270728v1_random:1148618-1148640 GGGAAGCTCTAGCCCCCAGTGGG - Intergenic
1143291671 17:5836124-5836146 GTGAGGCTTTGCCCTCCACTTGG + Intronic
1143305470 17:5943048-5943070 GGGAAGCTTTGACCTCTAAAGGG + Intronic
1148875879 17:50686895-50686917 GGGATGCTGTGGCCTCTGGTTGG + Intronic
1150132122 17:62674941-62674963 GGGAGGCTTTGGGGTCCAGGTGG - Intronic
1152027618 17:77822032-77822054 GGGAAGAGTCGGCATCCAGTAGG + Intergenic
1152700065 17:81814237-81814259 TGGACGCTTTGGCCACCAGAGGG + Intergenic
1153088786 18:1319776-1319798 GGATAGCTTTGGCCACCATTTGG - Intergenic
1161358175 19:3831390-3831412 GGGAAGCGGTGGCTTCGAGTCGG + Exonic
1161468230 19:4443921-4443943 GGGAAGCTTAGGACTTCAGGTGG - Intronic
1162021718 19:7871095-7871117 GGGAAGATTGGGTCTCCAGAGGG + Exonic
1162187041 19:8913874-8913896 GGGTAGCATTGACCTCCATTTGG - Intronic
1165940795 19:39413766-39413788 GGGAACGTTTGGGCTCCAGCTGG - Intronic
1166417425 19:42606504-42606526 GGGAAATTTTGCCCTCCAGGGGG + Intronic
1168141209 19:54388573-54388595 GGGAAGCCGTGGCATCCAGGTGG - Intergenic
1168180792 19:54661967-54661989 TGGAATGTTTGGCCTCAAGTGGG + Intronic
925881427 2:8356064-8356086 GGGAAACTTTGGCCCCTGGTTGG + Intergenic
926000060 2:9323403-9323425 GGGAAGCGTTAGCCTCCTGGAGG + Intronic
927317848 2:21706466-21706488 AGCAAACTTTGGGCTCCAGTGGG - Intergenic
930246858 2:48992438-48992460 GAGCATCTTTGGGCTCCAGTGGG - Intronic
932432899 2:71686161-71686183 GGGCAGCTTTGGCCCCCAGGTGG + Intronic
932628007 2:73314337-73314359 GGAGAGCTCTGGCCTGCAGTAGG - Intergenic
932681892 2:73833162-73833184 GGCAGGCTTTAGCCTCCAATTGG + Intronic
937080741 2:119137839-119137861 GGGGAGCTCTGGCCTCCAGAAGG + Intergenic
937313537 2:120916685-120916707 GGGAAGCCTTGACCTGCAGCAGG + Intronic
937876771 2:126831880-126831902 GGGAAGGTGTGGCCAGCAGTGGG - Intergenic
939473223 2:142651945-142651967 GGGAAGATTTGCCCTCCATGTGG - Intergenic
942330791 2:174821672-174821694 GGAAAGCTATGTCCTCCAGAGGG - Intronic
943795129 2:191983034-191983056 TGGGAACTCTGGCCTCCAGTAGG + Intronic
944354745 2:198773900-198773922 GGGAAGCTGCTGCCTCCAGCAGG - Intergenic
946072788 2:217048749-217048771 TGGATGCTCTGGCTTCCAGTAGG + Intergenic
946438850 2:219678339-219678361 GGGAACCTTTGGCCCCCTGCAGG - Intergenic
948447439 2:238043739-238043761 GGGAAGCTCTGACATCCAGTTGG + Intronic
1170326315 20:15157899-15157921 GGGGAGCCTTGGCCACCTGTGGG - Intronic
1170567142 20:17613758-17613780 GAGGGGCTGTGGCCTCCAGTCGG + Exonic
1172935442 20:38616809-38616831 GGGATGCTTTGGCGTCTAGTGGG + Intronic
1174199724 20:48798731-48798753 GAGGAGCTTTGGCATGCAGTAGG + Intronic
1175031087 20:55954792-55954814 GGGAACCTCTGTCCTACAGTGGG - Intergenic
1175126318 20:56754639-56754661 GGGAAGCTTTGCCCTCAATATGG + Intergenic
1181166156 22:20984141-20984163 GGGAAGCAATGGTCTCCAGTTGG - Intronic
1182109145 22:27710624-27710646 GGGCAGCTGTGCCCTCCAGATGG - Intergenic
1182642533 22:31780002-31780024 GGGAAGTTTTGTCTTTCAGTTGG + Intronic
1183481943 22:38070040-38070062 GGGAGGCTTTGGCCACCCGGTGG - Intronic
949876804 3:8631627-8631649 GAGAAGCTTAGGCCTCCAGTGGG + Intronic
950010646 3:9721215-9721237 GGGAAGCTCTGGTCTACAGAAGG - Intronic
950142811 3:10627127-10627149 GGGAAGCTTTGGCATCTGGCAGG - Intronic
950238030 3:11340744-11340766 GGGAAGCTGTTTTCTCCAGTCGG + Intronic
950315484 3:11998341-11998363 GAGAAGCTCTGGCCTCTTGTGGG - Intergenic
953382693 3:42486176-42486198 GGGAAGTGATGGCCTCCAGTTGG + Intergenic
954049618 3:47962989-47963011 GGCAAGCCTGGCCCTCCAGTGGG - Intronic
954242187 3:49302691-49302713 GGGAACCACTGGCCTCCTGTAGG - Intronic
956964853 3:74447244-74447266 TAGGAGCTGTGGCCTCCAGTAGG + Intronic
958128593 3:89388713-89388735 GGGAAACTTTGGACTACAGTAGG - Intronic
960264576 3:115605834-115605856 GGGAAGCTTCCACCTCCACTTGG + Intergenic
962387009 3:134939724-134939746 AAGAATCTTTGGCCTCCTGTGGG + Intronic
966274986 3:178154901-178154923 AGGAAGCTTTTGCCACCACTAGG + Intergenic
968277950 3:197455245-197455267 GGAAAATGTTGGCCTCCAGTGGG + Intergenic
968991300 4:3914728-3914750 GGGAAGCCTTGGCAACCATTAGG + Intergenic
969861020 4:10035349-10035371 GGGATGCTCTGGCCTCCTGGGGG + Intronic
971010055 4:22424257-22424279 GGGAAGCTAAAGCCTGCAGTAGG - Exonic
972008728 4:34147277-34147299 GGGAACAATTGACCTCCAGTTGG + Intergenic
972629926 4:40834043-40834065 GGGAAGCTGTGGGTTCCAGATGG - Intronic
973822575 4:54675986-54676008 GACAAGCTTTGGCAGCCAGTCGG - Intronic
981404154 4:144347593-144347615 GGAGATCTTTGTCCTCCAGTAGG + Intergenic
985856428 5:2430831-2430853 GAGAATCTCTGGCCACCAGTTGG - Intergenic
994132727 5:96248945-96248967 GAGAAGGTTTGGCCTTCTGTTGG + Intergenic
997236159 5:132272989-132273011 GGGCAGCTTTGCCCTCCAAGAGG + Exonic
997779047 5:136638769-136638791 GCACAGCCTTGGCCTCCAGTGGG + Intergenic
999786090 5:154891901-154891923 GGAAATGTTTAGCCTCCAGTTGG - Intronic
1000298975 5:159937960-159937982 GGGAAGCTTTGGCCTCCAGTGGG - Intronic
1000338833 5:160261515-160261537 GGGCAGCTTTGACCTCGCGTTGG - Intronic
1004205477 6:13587875-13587897 GGTAGGCTTTGGGGTCCAGTGGG + Intronic
1004534887 6:16490973-16490995 GGGAAGCTTCCTTCTCCAGTGGG - Intronic
1007068502 6:39017153-39017175 GGGAACCTTTGTGCTCCACTGGG + Intronic
1010896559 6:81371780-81371802 GGGAAGCTCTGGTATTCAGTTGG + Intergenic
1013579935 6:111523676-111523698 GGGAAGCTTTGGACCCAAGAGGG - Intergenic
1013825878 6:114210929-114210951 GGGAACCTTTGGCCTGGAGGAGG - Intronic
1018299867 6:162389775-162389797 GGAAAGCTTTGGACTCCACTAGG - Intronic
1019184592 6:170213736-170213758 GGGAAGCACTGGACTCCAGACGG + Intergenic
1019184631 6:170213945-170213967 GGGAAGCACTGGACTCCAGACGG + Intergenic
1019184701 6:170214313-170214335 GGGAAGCACTGGACTCCAGACGG + Intergenic
1019741272 7:2675705-2675727 GGTTTGCTGTGGCCTCCAGTGGG - Intergenic
1019799457 7:3077635-3077657 AGCATGCTTTGGCCCCCAGTGGG + Intergenic
1023256769 7:38320108-38320130 GGGGAGCTTGCGCCTCCATTTGG + Intergenic
1023700887 7:42891034-42891056 GGGAAGCTATACCCTCCTGTGGG - Intergenic
1023990291 7:45124624-45124646 GGCCAGCTTGGGCCTTCAGTGGG - Intergenic
1026480986 7:70779503-70779525 GGGTAGCTTTTGCTTTCAGTAGG + Intronic
1027269290 7:76511356-76511378 GGGAGGATGTGGCCTCCTGTGGG + Intronic
1027320003 7:77005251-77005273 GGGAGGATGTGGCCTCCTGTGGG + Intergenic
1028986661 7:97014973-97014995 GGGAAGCTGTCTTCTCCAGTTGG + Intergenic
1033618585 7:143041188-143041210 GGGAAACTTTAGACTCCAGCAGG - Intergenic
1033683656 7:143620506-143620528 GGGATGCTTTGGCCTGCATGGGG - Intergenic
1033691277 7:143740127-143740149 TGGAAGCTAGGGCCTGCAGTGGG - Intergenic
1033700956 7:143837132-143837154 GGGATGCTTTGGCCTGCATGGGG + Intergenic
1035589562 8:802349-802371 GGGAAGCTGTGGCCTGAGGTGGG - Intergenic
1038912576 8:31982956-31982978 GGGATTCTTTTGCCTCCATTAGG + Intronic
1041040785 8:53843851-53843873 GGGAAAATTTGGGCTCCAGATGG - Intergenic
1046966666 8:120174885-120174907 GGGCATCTTTTGTCTCCAGTGGG - Intronic
1048283041 8:133119473-133119495 GGGAAGATTTGGTGTCTAGTAGG + Intronic
1054573256 9:66831873-66831895 AGGAAGCCTTGGTCTCCAGAGGG + Intergenic
1057292322 9:93814543-93814565 GGGATGCTTCATCCTCCAGTGGG + Intergenic
1057984844 9:99702557-99702579 GGTCAGTTTTGGCCACCAGTGGG - Intergenic
1062605385 9:137345719-137345741 GGGAAGCTTTGGTATCCTTTTGG - Intronic
1062657857 9:137613468-137613490 GGGAAGCTGTGCTCTCCAGCGGG - Exonic
1189294296 X:39908066-39908088 AGGAGGGCTTGGCCTCCAGTGGG + Intergenic
1190552902 X:51603091-51603113 GTGAAGTTGTGACCTCCAGTGGG - Intergenic
1196764272 X:119228762-119228784 CAGAAGCTTTGGCATCCACTGGG - Intergenic
1198728404 X:139701098-139701120 GGGAAGTTTTTCCCTCCAGAGGG - Intronic
1200100477 X:153687470-153687492 GGGAAGCTGTAGCCCCCAGTGGG + Intronic