ID: 1000299238

View in Genome Browser
Species Human (GRCh38)
Location 5:159940416-159940438
Sequence CTGGCTAAACCGAACTAACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 3, 3: 7, 4: 84}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000299238 Original CRISPR CTGGCTAAACCGAACTAACA GGG (reversed) Intronic
906124172 1:43416477-43416499 CTGGCCAGACCAAACTCACAGGG - Intronic
906304774 1:44710139-44710161 CTGACCAAACCGAACAGACATGG + Intronic
906920743 1:50061941-50061963 CTGGGTAGACCCAACTAATACGG + Intronic
915680502 1:157577444-157577466 GTGGCCAAAACGGACTAACAGGG + Intronic
922719978 1:227895380-227895402 CTGGCTAAACCCACCTCACAGGG + Intergenic
922767587 1:228163919-228163941 CTGGCTAAACCCACCTCACAGGG - Intergenic
1076500798 10:130934501-130934523 CTTGCTAAACCGGTCTGACAGGG + Intergenic
1078311880 11:10251995-10252017 CAGGCCAAACCAAACTAAAATGG + Intronic
1081236255 11:40650803-40650825 CTGGCCAAAGAGAACTACCATGG - Intronic
1083301770 11:61743443-61743465 CTGGCTAAAAGGAACTTGCAGGG - Intronic
1088293811 11:108270090-108270112 CTGGCTATACTGAAATAATAAGG - Intronic
1092027953 12:5258829-5258851 CTAGAGAAACAGAACTAACAGGG - Intergenic
1095225607 12:39673339-39673361 CTGACTAAAATGAAATAACAGGG - Intronic
1101531534 12:105577621-105577643 TTTGCAAAACCGACCTAACAAGG + Intergenic
1106227908 13:27798854-27798876 CTGGCTGAACAGAATTTACAGGG + Intergenic
1107984967 13:45767677-45767699 CTTGCTAAACTGGCCTAACAGGG - Intergenic
1108745328 13:53387703-53387725 CTGAATTAACTGAACTAACAGGG - Intergenic
1112278706 13:98044266-98044288 CTGGCTAAACTGACTTAGCAGGG + Intergenic
1120517643 14:85489600-85489622 CTGACTAAATCGACCTAACAGGG - Intergenic
1128363852 15:66982854-66982876 CTGGCTAAACTGGGCTAAGATGG - Intergenic
1128963496 15:72033268-72033290 TTTGCTAAACTGAAGTAACAAGG + Intronic
1144220756 17:13097721-13097743 CTGGCTAAACTGACTTACCAGGG + Intergenic
1147623177 17:41881756-41881778 CTGGCTACACAGATCTACCAAGG + Intronic
1149034350 17:52117003-52117025 ATGGCTAAAGTGAACTAATAAGG + Intronic
1149224812 17:54457430-54457452 CAGGCCAAACCAAACTAAAATGG + Intergenic
1149386054 17:56144461-56144483 CTGGGTAAACCTGATTAACATGG - Intronic
1149732526 17:58960388-58960410 CTGGCTAAACCTGAATCACAGGG + Intronic
1153134937 18:1905867-1905889 CTGGCTAAACTGACTTAATAGGG + Intergenic
1155295541 18:24381266-24381288 CTGGGTAAACCAAACTAACAGGG + Intronic
1155324799 18:24655053-24655075 CTGTCTAAACTGACTTAACAGGG - Intergenic
1160005809 18:75068265-75068287 CTGGCTAAACCGATTTGGCAGGG + Intergenic
1163820710 19:19494998-19495020 CTGTCTCAAACAAACTAACAAGG - Intronic
925050184 2:807390-807412 CTGGAGAAACCAAGCTAACAAGG - Intergenic
925548977 2:5049692-5049714 CTGGCTAAAAAGCCCTAACAAGG - Intergenic
928562776 2:32508676-32508698 ATGTCTGAACCAAACTAACAAGG + Intronic
928687044 2:33760498-33760520 ATGGCTACACCGAACTACAAAGG + Intergenic
930176268 2:48304459-48304481 CTGGCTAAACTAACCTAAGAAGG - Intergenic
934698178 2:96415662-96415684 CTGGCTAAACCAACTTAGCAGGG - Intergenic
939034216 2:137111712-137111734 CTGGCTAAACAGAATAAACAAGG - Intronic
943110015 2:183592915-183592937 CTGGCTAATCCTGGCTAACACGG + Intergenic
943467797 2:188250987-188251009 CTGGCTAAAATGAAGTAATATGG + Intergenic
945256600 2:207808330-207808352 CTGGCTAAGACCGACTAACATGG - Intergenic
945833580 2:214812594-214812616 CTGGCTTAACAGGACTAATAAGG - Intergenic
945922028 2:215764491-215764513 CTGGCTAAGCATAGCTAACATGG - Intergenic
946810857 2:223523906-223523928 CTTGCTACCCTGAACTAACATGG + Intergenic
946872725 2:224099148-224099170 ATTTCTAAACAGAACTAACATGG - Intergenic
948751846 2:240137658-240137680 CTGGCTAAACCAACTTAGCAGGG - Intergenic
1179253895 21:39698577-39698599 GTGGCTAAACGGAACTCATAGGG + Intergenic
1185175751 22:49325571-49325593 CTGGCTACACTGACCCAACAGGG - Intergenic
949397629 3:3631753-3631775 CTGGCAAAACCTAATTATCAGGG + Intergenic
951187276 3:19728380-19728402 CAGGCCAAACCAAACTAAAATGG + Intergenic
952788361 3:37177096-37177118 CTGGCTGAAGCAAACAAACAAGG + Intronic
954685535 3:52368190-52368212 CTGGCTAAACTGACTTAGCAGGG + Intronic
955302054 3:57789540-57789562 CTGGCTAAACTGACTTAGCAAGG + Intronic
957603384 3:82367861-82367883 CAGGCCAAACCAAACTAAAATGG - Intergenic
958427130 3:93991863-93991885 CTGAATAAACATAACTAACAAGG - Intronic
962450269 3:135508066-135508088 CTGGCTAAGACGAAATAACAGGG + Intergenic
964016050 3:151948134-151948156 CTGGCTAAACAGTCTTAACAGGG + Intergenic
964275149 3:155001492-155001514 CTGGCTAAACTTGCCTAACAGGG - Intergenic
965488864 3:169312568-169312590 CTGGCTAATCCTGTCTAACACGG - Intronic
978340172 4:107714189-107714211 CTGACTAAAACGATTTAACAGGG - Intronic
978886202 4:113769097-113769119 GTGGCTAAACCTAACCACCAAGG + Intergenic
983426388 4:167589060-167589082 CTGGCCAAACCAACCTAACAGGG + Intergenic
984665566 4:182424643-182424665 CTGCCTAAAACGAACTAAATTGG + Intronic
985878790 5:2621285-2621307 CTGTCCAAACCAAAGTAACAGGG - Intergenic
993953361 5:94202048-94202070 CTGGCTAAACTGATTTAGCAAGG + Intronic
998476628 5:142427678-142427700 CTGGGTAAACACAACAAACAAGG + Intergenic
999050871 5:148522784-148522806 CTGGCTAAACAAACCTAGCAGGG + Intronic
1000299238 5:159940416-159940438 CTGGCTAAACCGAACTAACAGGG - Intronic
1001117636 5:168952968-168952990 CTGGCTAAAGCCACCTAACAAGG + Intronic
1012669311 6:102020596-102020618 CTTGCTAAACTGACTTAACAGGG + Intronic
1016428082 6:143955612-143955634 CTGACAAAACCAAACTACCAAGG + Intronic
1017447520 6:154520854-154520876 ATGGCTAAATCAAACTAAGAGGG + Intergenic
1017926309 6:158914292-158914314 CTGGCTATACTCAACTAAGAGGG - Intergenic
1018830930 6:167442939-167442961 CTGGCTAAACCGCAGTGACTTGG - Intergenic
1021812716 7:24418974-24418996 CTGGCTAAGCTGATATAACAAGG + Intergenic
1022378830 7:29840980-29841002 CTTGCTAAACCGACGTAGCAGGG + Intronic
1024227477 7:47337100-47337122 CTTGCTAAACTGGCCTAACACGG - Intronic
1029810729 7:103045689-103045711 CAGGCCAAACCAAACTAAAATGG - Intronic
1035241477 7:157533430-157533452 CTTGCTAAACTGACTTAACATGG - Intergenic
1035241909 7:157537764-157537786 CTGGCTAAACCCACCTAACAGGG - Intergenic
1039733925 8:40309599-40309621 CTGGCTAAACTGACTTAGCAGGG - Intergenic
1039734251 8:40313927-40313949 CTGGCTAAACTGACTTAGCAGGG - Intergenic
1048061217 8:130921019-130921041 CTGGAGAAACAGAACCAACAGGG - Intronic
1048519902 8:135143800-135143822 CTGGCTCAACTGGCCTAACAGGG - Intergenic
1056289912 9:85132697-85132719 CTGGGTACAGCAAACTAACATGG + Intergenic
1056740394 9:89249561-89249583 CTGGCTAAAGTGACCTAAAAGGG + Intergenic
1059474372 9:114532633-114532655 CTGGCTAAACTGAAAGAATAGGG + Intergenic
1062314928 9:135962226-135962248 CTGGCTAAACCGACCTGACAGGG - Intergenic
1189320858 X:40086407-40086429 CTGGCCAAACCCCACCAACACGG + Intronic
1192614237 X:72601578-72601600 CTGGCTAAACTGACTTAGCAGGG + Intronic
1192765427 X:74134667-74134689 TTGGCTAAACTCAAGTAACAAGG + Intergenic
1193422450 X:81298170-81298192 ATGGCTAAACTGAAATAAAAAGG - Exonic
1193444657 X:81585937-81585959 CTGGATAAAACTAACTTACATGG - Intergenic
1199638541 X:149836898-149836920 CAGTCTAACCCTAACTAACAGGG + Intergenic