ID: 1000300312

View in Genome Browser
Species Human (GRCh38)
Location 5:159950686-159950708
Sequence GCATTGGAGTGTCCCCCCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 61
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 54}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000300312_1000300319 29 Left 1000300312 5:159950686-159950708 CCCTTGGGGGGACACTCCAATGC 0: 1
1: 0
2: 0
3: 6
4: 54
Right 1000300319 5:159950738-159950760 ATTTGGCAGGTTTTTCGAGACGG 0: 1
1: 9
2: 11
3: 20
4: 242
1000300312_1000300318 16 Left 1000300312 5:159950686-159950708 CCCTTGGGGGGACACTCCAATGC 0: 1
1: 0
2: 0
3: 6
4: 54
Right 1000300318 5:159950725-159950747 TTAATGTCATCATATTTGGCAGG 0: 1
1: 12
2: 12
3: 27
4: 244
1000300312_1000300317 12 Left 1000300312 5:159950686-159950708 CCCTTGGGGGGACACTCCAATGC 0: 1
1: 0
2: 0
3: 6
4: 54
Right 1000300317 5:159950721-159950743 CTTCTTAATGTCATCATATTTGG 0: 1
1: 12
2: 29
3: 130
4: 730

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000300312 Original CRISPR GCATTGGAGTGTCCCCCCAA GGG (reversed) Intronic
902196713 1:14803663-14803685 GCACTGGAGTGACTCCCCAGAGG - Intronic
904553291 1:31339596-31339618 GCATTGGAGTGCTCCATCAATGG + Intronic
905322505 1:37128061-37128083 GCATAGGACTGTCACCCCACAGG - Intergenic
1070363890 10:75717204-75717226 GCCTTGGGGAGTCCCCCCCAGGG + Intronic
1074501053 10:114025203-114025225 GCACTGGAGTGTCCCTGCCATGG - Intergenic
1076451462 10:130559840-130559862 GCATTGGTGTTTGCCCCCAGGGG + Intergenic
1077299725 11:1841337-1841359 GCAGTGGAGTGTCCCCTGCATGG - Intronic
1082135098 11:48539171-48539193 ACATTGGAATGTCCTCCCTAAGG - Intergenic
1091297764 11:134485965-134485987 GAATTGGAGTGTCTCACCAGAGG + Intergenic
1091447069 12:549939-549961 GCAGTGCAGTGTCCCCAGAAAGG - Intronic
1095097801 12:38157499-38157521 GCTTTGGGGTGTCCCCCCGTGGG - Intergenic
1102466308 12:113132748-113132770 GCATTGGAGTGTCCAGCCAGAGG - Intronic
1106891991 13:34255602-34255624 ACATTTGAGTGTCCACCTAATGG + Intergenic
1111858610 13:93671906-93671928 TCATTGTAGTGTCCCCGCACTGG - Intronic
1118254144 14:64190553-64190575 GCATTTGTGTGTCCCCACAGTGG + Intronic
1136104607 16:28020862-28020884 GCACTGGAGAATCCTCCCAAGGG - Intronic
1136778113 16:32882245-32882267 GGATGGGAGTGGCCTCCCAAAGG - Intergenic
1136892508 16:33979269-33979291 GGATGGGAGTGGCCTCCCAAAGG + Intergenic
1203080532 16_KI270728v1_random:1144354-1144376 GGATGGGAGTGGCCTCCCAAAGG - Intergenic
1150619282 17:66797254-66797276 GGATTGCAGTGTGCCCCCACTGG - Intronic
1165497749 19:36163574-36163596 CCATAGGAGTGCCCACCCAAGGG - Intergenic
1166969919 19:46559427-46559449 GCATTGGAGGACCCCCTCAAGGG + Intronic
925418164 2:3688176-3688198 GCATTGGAGGGCCCCCTCAAGGG - Intronic
929753425 2:44741261-44741283 GCATGGGAGTGTATCTCCAAAGG + Intronic
937482623 2:122278030-122278052 GCATTGGAGTTTCCCCTCCACGG - Intergenic
938133044 2:128733570-128733592 GCAGGGGAGTGTCTCCCAAAGGG + Intergenic
947921400 2:233877966-233877988 GCATAGGAATGTCCTTCCAAAGG - Intergenic
1169519939 20:6360107-6360129 CCAGTGGAGTGTCCCCCGGAAGG - Intergenic
1170243165 20:14192667-14192689 GCAAAGGAGTCTCCCCACAAGGG + Intronic
1178096708 21:29223070-29223092 GCATTGGAGGGCCCCTTCAAGGG + Intronic
1181404721 22:22674655-22674677 TCTTTGGAGTGTTCCCTCAAGGG - Intergenic
1181413294 22:22740169-22740191 TCTTTGGAGTGTTCCCTCAAGGG - Intronic
952228524 3:31404365-31404387 GCTTTGGAGTGTTCCCTCTATGG - Intergenic
954656930 3:52199584-52199606 TCATATGATTGTCCCCCCAAGGG + Intronic
963292196 3:143503461-143503483 GCTTTGGAGGGTCCCCTCAAGGG - Intronic
975377134 4:73658872-73658894 GCATTAGAGTGGCCTGCCAAAGG - Intergenic
977178085 4:93839543-93839565 GCTTTGGAGGGTCTCCCAAATGG - Intergenic
978830455 4:113077984-113078006 CCAATTGAGTTTCCCCCCAAGGG - Intronic
979602614 4:122603201-122603223 GCAATGGAGTTTCTCCCGAAGGG + Intergenic
980870293 4:138603453-138603475 GCATTGGAGTAGCACCACAAAGG + Intergenic
1000300312 5:159950686-159950708 GCATTGGAGTGTCCCCCCAAGGG - Intronic
1003404557 6:5817610-5817632 GTATTGGAGGGCCCCCTCAAGGG - Intergenic
1009895737 6:69746636-69746658 GCATTGGAGGGTCCCTTCAAAGG + Intronic
1024364757 7:48508144-48508166 GCCTTGGAGTGTCCACAAAAAGG + Intronic
1027461013 7:78453639-78453661 GCATTGCACTGGCCACCCAATGG - Intronic
1032870034 7:135975662-135975684 GTATTGCAGTGTCCCACCACTGG + Intronic
1033102193 7:138483671-138483693 GCAATGTAGTGTCCTCCCCAGGG - Intronic
1036782811 8:11661285-11661307 GCATTGGAGTCTCTAGCCAACGG - Intergenic
1044139917 8:88637593-88637615 CCAGTGGAGTGTTCCCCCAGAGG - Intergenic
1049215067 8:141404026-141404048 GCATGGGAGTGTGCCCCGAGAGG - Intronic
1052995956 9:34551791-34551813 GCATTGGAGGGTCCAGCCCAAGG + Exonic
1056792313 9:89633701-89633723 GCATCAAAGTGTCCCACCAAAGG - Intergenic
1062252933 9:135607470-135607492 GCCTTGTTGTGTCCCCACAATGG - Intergenic
1185832835 X:3317754-3317776 GCAATGGAGTGTCTGGCCAAAGG - Exonic
1185854785 X:3524048-3524070 GTCATGGAGTGTCCCCCCACCGG + Intergenic
1188363602 X:29286816-29286838 GCATTCCAGTGCCCCCCAAATGG + Intronic
1189175237 X:38950054-38950076 GCAATGGAGTCTTCCCCCCAAGG - Intergenic
1189276114 X:39787325-39787347 GCATCGGAGGGCCCCCTCAAGGG - Intergenic
1192448790 X:71229908-71229930 GAATTGGAGAGTCTCTCCAAGGG - Intergenic
1199877929 X:151949661-151949683 GCAATGGGGTTTCCCCCCAACGG + Intergenic
1200101720 X:153691794-153691816 GGATGGGAGTGGCCTCCCAATGG + Intronic