ID: 1000302076

View in Genome Browser
Species Human (GRCh38)
Location 5:159965463-159965485
Sequence GTGTGGTGGGTGAAGCTGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 331
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 306}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000302076_1000302085 13 Left 1000302076 5:159965463-159965485 CCCAGCAGCTTCACCCACCACAC 0: 1
1: 0
2: 1
3: 23
4: 306
Right 1000302085 5:159965499-159965521 CAGGTCTGTTTGGCTGCCCAGGG No data
1000302076_1000302081 -6 Left 1000302076 5:159965463-159965485 CCCAGCAGCTTCACCCACCACAC 0: 1
1: 0
2: 1
3: 23
4: 306
Right 1000302081 5:159965480-159965502 CCACACTCTTCTCCAGTGACAGG 0: 1
1: 0
2: 1
3: 16
4: 177
1000302076_1000302084 12 Left 1000302076 5:159965463-159965485 CCCAGCAGCTTCACCCACCACAC 0: 1
1: 0
2: 1
3: 23
4: 306
Right 1000302084 5:159965498-159965520 ACAGGTCTGTTTGGCTGCCCAGG 0: 1
1: 0
2: 3
3: 13
4: 174
1000302076_1000302086 14 Left 1000302076 5:159965463-159965485 CCCAGCAGCTTCACCCACCACAC 0: 1
1: 0
2: 1
3: 23
4: 306
Right 1000302086 5:159965500-159965522 AGGTCTGTTTGGCTGCCCAGGGG No data
1000302076_1000302082 3 Left 1000302076 5:159965463-159965485 CCCAGCAGCTTCACCCACCACAC 0: 1
1: 0
2: 1
3: 23
4: 306
Right 1000302082 5:159965489-159965511 TCTCCAGTGACAGGTCTGTTTGG 0: 1
1: 0
2: 0
3: 15
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000302076 Original CRISPR GTGTGGTGGGTGAAGCTGCT GGG (reversed) Intronic
900095469 1:938354-938376 AGGAGGTGGGTGAAGCTACTGGG + Intronic
901025741 1:6277889-6277911 GTGGGGTGGGTGAAGATGGGGGG - Intronic
901135156 1:6988210-6988232 GTGCGCTGGGTGATTCTGCTGGG + Intronic
902177606 1:14662520-14662542 GTTTGGAGGGAGGAGCTGCTAGG - Intronic
903134976 1:21303274-21303296 GGGTGGAGGGTGAGGCCGCTGGG - Intronic
904094836 1:27968479-27968501 ATGTGGTGGGTGATGGTGCTGGG + Intergenic
904622261 1:31782517-31782539 GGGTGGTGGGTGCTGCTGGTAGG - Intergenic
904891209 1:33780989-33781011 GAGTGGTGAGTGATGCTGGTCGG + Intronic
905014508 1:34768078-34768100 GTGTGGTGGGTGAGGAGGGTGGG - Intronic
905058701 1:35121145-35121167 GTGTTGGGGTTGTAGCTGCTGGG + Intergenic
905127675 1:35726942-35726964 GTGTGGGGCGTGAAGTTGCCGGG + Intronic
905173499 1:36122926-36122948 GTGTGGAGGGGGAAGCTTCAGGG - Intronic
905285878 1:36880006-36880028 GTGTGGCGGGTGAAGGTGTGAGG + Intronic
906326670 1:44850445-44850467 GTGAGGTGGGGGAAGGGGCTGGG + Intergenic
907291940 1:53420606-53420628 GAGTGGTGGGTGAAGGTGGGAGG - Intergenic
908413979 1:63894494-63894516 CTGTGGTGTGTGAAGATGATGGG - Intronic
908440540 1:64149562-64149584 GAGATGTGGGTGGAGCTGCTGGG - Intronic
909423805 1:75497485-75497507 GAGTGGTAGGTGGAGATGCTGGG + Intronic
911726564 1:101247382-101247404 CTGTGCTAGGTGGAGCTGCTTGG + Intergenic
912475093 1:109929826-109929848 GTGGGGTGGGAGAACCTCCTGGG + Exonic
914827209 1:151145121-151145143 ATGGGGTGTGTGAAGCAGCTCGG - Intronic
915320379 1:155052905-155052927 GTGTGGTGGGAGAGGCAGCTGGG - Intronic
915367530 1:155324200-155324222 GGGTGGAGGGTGAAGCTCCCGGG + Intronic
918081154 1:181208739-181208761 TTGTGATGGGGGAAGCTTCTTGG - Intergenic
920681636 1:208077468-208077490 GAGTGGATGGTGCAGCTGCTGGG + Intronic
920712265 1:208306549-208306571 ATGTGGTCAGTGAAGCTTCTGGG + Intergenic
920761431 1:208786952-208786974 GTGTGGTGGCTAGAGCTGTTAGG - Intergenic
923087565 1:230713068-230713090 GTGTGGTGGGGAAAGCTGCAGGG - Intronic
1063226445 10:4019435-4019457 AGGTGGTGGGTGAAGCAGCCAGG - Intergenic
1063506857 10:6607435-6607457 GTGTGGTATGTGAGGCTGGTGGG - Intergenic
1066320181 10:34295217-34295239 CTGGGGTGGGTGAAGCAGCAAGG + Intronic
1066371997 10:34825180-34825202 GTGAGGTGGGTGAACAAGCTTGG - Intergenic
1067829828 10:49605204-49605226 GTGTGGAGGGAGGAGCTCCTGGG + Intergenic
1069754247 10:70763623-70763645 GTCTGGTGGGTGCAGGTGCCAGG + Intergenic
1069928052 10:71864962-71864984 CTGTGGTGGGTGAATCAGTTGGG - Intergenic
1069984877 10:72276220-72276242 CTGTGCTGGCTGAAGCTACTAGG + Intergenic
1072659656 10:97355970-97355992 GTGTGGTGGGACAGGCTGCCAGG + Intergenic
1073110881 10:101062406-101062428 GTGTGTTGGGGGAGGCTACTTGG + Intronic
1073159010 10:101373547-101373569 GTTTGGTGGGTGAAGATATTGGG + Intronic
1076600969 10:131656758-131656780 GTGTGGTGTGTGACTCTGCATGG - Intergenic
1077155459 11:1089032-1089054 GTGTGGTGCGTGACGCAGCAGGG - Intergenic
1077375709 11:2204273-2204295 GAGTGGTGGGTGGGGCTTCTGGG + Intergenic
1078150814 11:8758287-8758309 GTGTGGTGGAAGAAGCTAATGGG - Intronic
1079537029 11:21526871-21526893 CTGTGATGGGAGGAGCTGCTGGG + Intronic
1081859283 11:46323211-46323233 GTGTGTTGTCTGAAGCTGCCAGG + Intergenic
1084191224 11:67499854-67499876 ATGGGGTGGGAGGAGCTGCTCGG + Intronic
1085528941 11:77180292-77180314 GTTGGGTGGGTGGAGCTGGTGGG + Intronic
1087762355 11:102114272-102114294 GAGCTGTGGGTGTAGCTGCTGGG - Exonic
1088620249 11:111674389-111674411 GTCTGGTGGGTGAACTGGCTTGG + Intronic
1089083730 11:115799298-115799320 GGTTGGTGGGGGAAGCAGCTTGG + Intergenic
1089330272 11:117684479-117684501 GTGTGTGGGGTGAAGACGCTAGG + Intronic
1089541811 11:119193741-119193763 GTGTGGTCGGTTAAGCAGGTGGG - Intronic
1089653287 11:119929107-119929129 GTGAGGTGGGTGAAAATGCATGG - Intergenic
1090866670 11:130706857-130706879 TTGTGGTGGGTGAGTGTGCTGGG + Intronic
1091442218 12:520110-520132 GAGTGGTGGGAGAAATTGCTGGG + Intronic
1091792945 12:3281832-3281854 GCAGGGTGGGTGAGGCTGCTGGG - Intronic
1094754675 12:33454316-33454338 AGGTGGTGGGTGAAGCTGAGGGG - Intergenic
1095307178 12:40651991-40652013 ATATGGTGGGTGAATCTACTGGG - Intergenic
1096837342 12:54359173-54359195 GGGAGGGGGGTGCAGCTGCTAGG - Intergenic
1096917574 12:55049791-55049813 GAGTGGGGGGTGAAGGTACTGGG + Intergenic
1097241913 12:57581440-57581462 GGTTGGTGGGTGAGGATGCTGGG - Exonic
1100500129 12:95166063-95166085 GTGTGGTGGGGCAAGCCCCTGGG - Intronic
1101043705 12:100783185-100783207 GTGTGGTGGGTGCTGATGGTAGG + Intronic
1102191304 12:110990704-110990726 GTGTGGTGGCAAAAGCTGATCGG - Intergenic
1102216959 12:111168477-111168499 GTGTGGTGGGAGGTCCTGCTTGG - Intronic
1103404022 12:120662286-120662308 TTGTGATCAGTGAAGCTGCTAGG + Intronic
1105375132 13:19837155-19837177 GTGTGGTGGCGCAAGCTACTTGG - Intronic
1106302894 13:28485761-28485783 GTGTGATGGTGGAAGCTGCAAGG - Intronic
1108495046 13:51017196-51017218 GTGTGCTGGGTGATGCTGAATGG - Intergenic
1110507046 13:76299038-76299060 GTGGGGTGGGGGAAGCGGGTAGG + Intergenic
1111887884 13:94046072-94046094 GAGTGGAGGGTAGAGCTGCTGGG - Intronic
1112422635 13:99266950-99266972 GTGTTGCTGGTGCAGCTGCTGGG - Intronic
1114793855 14:25689922-25689944 GTGTGGTGGGTCAGGGTCCTAGG - Intergenic
1115650744 14:35401386-35401408 GTCAGGTGTGAGAAGCTGCTGGG + Intergenic
1119763992 14:77176543-77176565 TGGTGCTGGGTGAGGCTGCTAGG - Intronic
1120030218 14:79632351-79632373 GTGTGGTTGGAGAAGGTCCTTGG + Intronic
1120919747 14:89744093-89744115 GTCTGATGGGGGAAGCTGCTAGG - Intergenic
1121303665 14:92891504-92891526 GGGTGGTGGGTGCAGCAGTTTGG - Intergenic
1121440284 14:93944618-93944640 GCCTGGTGGCAGAAGCTGCTGGG + Intronic
1121660139 14:95628887-95628909 GTGTGATGTTTTAAGCTGCTAGG - Intergenic
1124214120 15:27792525-27792547 GTGTGGGAGGTGAGGCTGCTTGG - Intronic
1125236947 15:37525527-37525549 GGGTGCTGGGCGAAGCTGGTGGG + Intergenic
1125968550 15:43893695-43893717 GTGTGGGGGCTGAGGCTGCTGGG + Intronic
1126814999 15:52446141-52446163 CTGTGGTGGGAGGGGCTGCTGGG - Intronic
1127582106 15:60347878-60347900 GTGTGGTCGGAGGAGGTGCTGGG + Intronic
1130543250 15:84836989-84837011 GTGGGGTTGGTGATGCTGATGGG + Intronic
1130987317 15:88853063-88853085 GGCTGCTGGGTGAGGCTGCTAGG - Intronic
1131058238 15:89389211-89389233 GTGTGGTGTGAGCAGCCGCTGGG + Intergenic
1131936340 15:97509775-97509797 ATGTGGTTGGTGAGGCTGCAAGG - Intergenic
1131955492 15:97730938-97730960 GTGTGGTTGGTGGGGGTGCTGGG - Intergenic
1132149163 15:99447456-99447478 GAGTGGAGGGTAAACCTGCTTGG - Intergenic
1132711624 16:1271451-1271473 GTGACGTGGGTGAGGGTGCTGGG + Intergenic
1132711680 16:1271660-1271682 GTGATGTGGGTGAGGGTGCTGGG + Intergenic
1132711703 16:1271744-1271766 GTGACGTGGGTGAGGGTGCTGGG + Intergenic
1133344396 16:5060292-5060314 GTGTGCCTGGTGCAGCTGCTGGG - Exonic
1134647469 16:15881644-15881666 GTGGGGTGGGGGATGCAGCTGGG - Intronic
1134710630 16:16325617-16325639 GCCTGGTGGGTGTGGCTGCTGGG - Intergenic
1135222628 16:20625791-20625813 TCGTGTTGGGGGAAGCTGCTTGG - Intronic
1135745477 16:25013227-25013249 GTGTGGTGGGAGAGGCTTCCAGG + Intronic
1136233824 16:28902919-28902941 GGGTGGTGGGTGTAGCTGGGGGG - Intronic
1136598178 16:31265955-31265977 TTGTGGAGGGTGGAGGTGCTGGG + Intronic
1136684661 16:31986993-31987015 ATGAGGTGGGTGAAGCTGGGGGG + Intergenic
1136785285 16:32930529-32930551 ATGAGGTGGGTGAAGCTGGGGGG + Intergenic
1136884497 16:33923275-33923297 ATGAGGTGGGTGAAGCTGGGGGG - Intergenic
1137584022 16:49653221-49653243 GTGTAGTGGGTAGAGGTGCTGGG - Intronic
1137769260 16:51003165-51003187 GTGTGGTGGGGGGACCTGCTGGG + Intergenic
1139511149 16:67429286-67429308 GTGTGGTGGCTAAAGCTGGGGGG + Intergenic
1141343903 16:83228021-83228043 GGGTGGTGGGAGACACTGCTTGG + Intronic
1141652754 16:85402328-85402350 GTCTGGTTGGAGAAGCTGCCAGG + Intergenic
1142255827 16:89013471-89013493 AAGTGGGGGCTGAAGCTGCTGGG + Intergenic
1142372739 16:89692043-89692065 CTGTGGTGGGGGCATCTGCTGGG + Intronic
1144016454 17:11200848-11200870 GTGGTGTGGGTGATGATGCTGGG - Intergenic
1144209969 17:13005894-13005916 GTGTGGGGGGTAAGGCTTCTGGG - Intronic
1144619722 17:16809921-16809943 CCGTGGTGGGGAAAGCTGCTTGG + Intergenic
1144674825 17:17155177-17155199 GTGCTGTGGGTTAGGCTGCTTGG + Intronic
1145139254 17:20438509-20438531 CCGTGGTGGGGAAAGCTGCTTGG + Intergenic
1147145596 17:38482674-38482696 ATGAGGTGGGTGAAGCTGGGGGG + Exonic
1147156809 17:38548117-38548139 GTGTGGTGACTGACACTGCTGGG + Intronic
1147381967 17:40061694-40061716 GTGTGTTAGGGGGAGCTGCTCGG - Intronic
1148028573 17:44604952-44604974 GGGTGGTTGCTGCAGCTGCTGGG - Intergenic
1148731511 17:49839644-49839666 GTGGGGAGGGTGCAGCTTCTGGG + Intronic
1149770353 17:59315941-59315963 GTCTGGTCAGTCAAGCTGCTAGG + Intergenic
1150221389 17:63497528-63497550 GTGTGCTGGGAGAAGGGGCTGGG - Intronic
1151522698 17:74641618-74641640 GTGGGGTGGGGGAGGCTGGTGGG - Intergenic
1152119381 17:78408829-78408851 GTGTGGTGGGACAAGGTTCTGGG + Intronic
1152223934 17:79083978-79084000 GTGTGATGGGAGAAGCTGGTGGG - Intronic
1152470386 17:80487827-80487849 TCGAGGTAGGTGAAGCTGCTTGG + Intergenic
1152687663 17:81702602-81702624 GTGTAGTGGCTGAAGCTTCCCGG + Intronic
1153135570 18:1913471-1913493 TTGGGGTGGCTGAAGCAGCTGGG + Intergenic
1153522992 18:5969375-5969397 ATGAGGTGAGTGGAGCTGCTGGG - Exonic
1154163478 18:11996915-11996937 GTGTGGTGTGGGAAGATGCAGGG - Intronic
1154284970 18:13046099-13046121 GTGTGGTGTGGGCATCTGCTTGG + Intronic
1154299048 18:13176716-13176738 GGTTGCTGGGTGAAGATGCTAGG + Intergenic
1155675779 18:28426585-28426607 GTGTTGTGGGTGGACCTGGTGGG + Intergenic
1157177292 18:45463308-45463330 AGCTGGTGGGTCAAGCTGCTGGG - Intronic
1157437615 18:47684088-47684110 GTGAGGTGAGTGAGGCTCCTAGG + Intergenic
1158563712 18:58536584-58536606 CCGTGGTGGCTGAAACTGCTGGG - Exonic
1159960814 18:74554686-74554708 GTCTGGTGGGAGAAGCAGGTGGG + Intronic
1160312256 18:77806558-77806580 GTTTGGTTGGTTATGCTGCTTGG + Intergenic
1161650587 19:5481969-5481991 ATGTGTTGCTTGAAGCTGCTAGG - Intergenic
1161716346 19:5878035-5878057 CTGTGGTGGGTGAAGAGGCGGGG + Intronic
1162246585 19:9406681-9406703 CCCTGGTCGGTGAAGCTGCTGGG + Intergenic
1163612940 19:18310412-18310434 GTGTGGTGGGTGAAGAGGGGCGG + Intronic
1164580613 19:29432850-29432872 GTGAGGTGGGTGAGGCTGCACGG - Intergenic
1165242654 19:34480995-34481017 GGGTGGTGGGTGAGGCTTCGAGG - Intergenic
1165336812 19:35176379-35176401 GGGTGGAGGGAGAAGCTCCTTGG + Intergenic
1165585792 19:36915112-36915134 GTGTGGTGGGTAATGGGGCTGGG - Exonic
1167238530 19:48329545-48329567 GTGGGGTGTGTCAAGATGCTGGG + Intronic
1167598085 19:50437768-50437790 AGGTGGTGGGTGAAGCTCCATGG + Intronic
1168113909 19:54210129-54210151 GAGTCGTGGGTGAAGCTGATAGG + Intronic
925054259 2:844218-844240 GTGTGGTGGCTGGAGCTGAATGG - Intergenic
925451748 2:3974938-3974960 GTGTGGTGAGTGAAACTGTGTGG - Intergenic
925629910 2:5881534-5881556 GTGTGGTGAGATAAGCTCCTTGG + Intergenic
926354056 2:12023530-12023552 AGGTGGTGGGTGAAGCTGGGGGG - Intergenic
926470629 2:13252342-13252364 GTGTGGAAAGTGGAGCTGCTTGG + Intergenic
927576147 2:24203516-24203538 TTGTGAGGGGTGAAGCTGCATGG + Exonic
928089268 2:28364041-28364063 GTGGGGTGGGTGGAGGTGCCAGG + Intergenic
930364206 2:50418365-50418387 GTGTGTTGGGGGAGGCTGCAAGG - Intronic
930626977 2:53709112-53709134 CTGTGATGGGTAAGGCTGCTGGG - Intronic
930885681 2:56323143-56323165 GTGGGGTGGGTGAAGCGGGGAGG + Intronic
931924241 2:67054044-67054066 GTATGGTGGGTGAGGCAGGTGGG - Intergenic
937128192 2:119487896-119487918 GTGTGGGGGGAGGGGCTGCTGGG - Intronic
937496713 2:122428206-122428228 GTGTGGAAGGTGGAGTTGCTGGG - Intergenic
937624100 2:124024733-124024755 GTGCGGTGGGAGTAGCTGCGGGG + Intergenic
937753348 2:125505020-125505042 GTGTTGTGGGAGCAGCTGGTGGG - Intergenic
938296427 2:130182218-130182240 GGGTGGTGGGCGCAGCCGCTAGG + Exonic
940355676 2:152738729-152738751 TTGTGATGGGAGAGGCTGCTGGG + Intronic
941079617 2:161045529-161045551 GAGTGGTGGGTGAAGATGGAAGG - Intergenic
943283710 2:185970471-185970493 GTGTGGTGGGAGAAACTACAGGG + Intergenic
943363852 2:186950807-186950829 GTGGGATGGGAGAAGCTTCTAGG + Intergenic
944443017 2:199761698-199761720 GTGTAGTGGATGAAGATGTTGGG - Intronic
945374013 2:209057855-209057877 GTGTACTGGGAGAAGGTGCTGGG + Intergenic
945683276 2:212938635-212938657 CAGTGGTGAGTGAAGCTGATGGG + Intergenic
945683375 2:212939515-212939537 CGGTGGTGAGTGAAGCTGCTGGG - Intergenic
946081957 2:217128154-217128176 GGGTGATGGGTGGAGCTGCTGGG + Intergenic
947118742 2:226796916-226796938 GTGTGGAGGGTGGAGCTGTCTGG + Exonic
947807622 2:232979533-232979555 TTGGGGTGGGGGAAGCTTCTGGG - Intronic
948469002 2:238165541-238165563 GTGTCGTAGGTGAAGTTGGTGGG + Intronic
1169027138 20:2380781-2380803 GTCTCGTGGGTGTCGCTGCTAGG + Intergenic
1169598236 20:7225969-7225991 GAGTGGTGGGCCAGGCTGCTGGG + Intergenic
1170557334 20:17525468-17525490 GTGTGGGGAGTGATGCTGCTGGG - Intronic
1171089834 20:22274141-22274163 GTGTGGTGGCTGAGCCTGCATGG - Intergenic
1171329406 20:24324402-24324424 GTGAGGTGGGTCCAGATGCTTGG + Intergenic
1172187527 20:33040395-33040417 GTGTGCTGGGTGGATCAGCTCGG - Intronic
1172775177 20:37403103-37403125 GTGGGGTGGGGGAAGCTGATGGG - Intronic
1173021566 20:39272040-39272062 GGCTGGTGGGAGACGCTGCTAGG - Intergenic
1173058069 20:39635670-39635692 GGGTGGTGGCTGAAGCTGGTTGG + Intergenic
1174043169 20:47714429-47714451 GTCCTGAGGGTGAAGCTGCTGGG - Intronic
1174397665 20:50257956-50257978 ATGTGGCGGGGGCAGCTGCTTGG + Intergenic
1176939644 21:14909313-14909335 GTGTGGTGGTTCACGCTACTTGG - Intergenic
1177139648 21:17344508-17344530 CTGTGGTGGGAGAGGCTGCCAGG - Intergenic
1177912026 21:27044449-27044471 GTGTGGTGGCTGAAGCAGTGAGG + Intergenic
1179157074 21:38859909-38859931 ATGTGGTGGGTGTACATGCTGGG + Intergenic
1179547409 21:42122085-42122107 GTGAGCTGGGTGGAGCTGCAGGG + Intronic
1179646626 21:42779904-42779926 GTGTGATGTGTGAGTCTGCTGGG - Intergenic
1180685743 22:17664928-17664950 CTGTGATGGGAGGAGCTGCTTGG + Intronic
1181831001 22:25560063-25560085 GTGTGCTGAGTGCAGATGCTGGG + Intergenic
1182090835 22:27593719-27593741 GGGTTGTGGCTGAAGCTGCCTGG - Intergenic
1182572254 22:31248261-31248283 GTGTGGTTGGAGCAGCTGTTAGG - Intronic
1183259112 22:36782773-36782795 GTGTGGTGGGTGCAGCTGCCGGG - Intergenic
1183396155 22:37571990-37572012 ATGAGGTGGATGAAGCTGCTGGG - Intronic
1183729085 22:39607092-39607114 GGGTGGAGGGTGAGGCTACTGGG + Intronic
1184513733 22:44947525-44947547 GTGTGCTGGGTGCATCTCCTGGG + Intronic
1185047132 22:48534173-48534195 GTGAGGTGGGTCAAGCAGGTGGG + Intronic
950006137 3:9692137-9692159 ATGTGGTAGGAGAAGCTGTTTGG + Intronic
952168642 3:30780017-30780039 GTGTACTGGGGGAAGCTACTGGG - Intronic
952726070 3:36586156-36586178 TTGTGGTTGGAGAAGATGCTTGG - Intergenic
954128919 3:48549824-48549846 GTGTGGGGGGAGAGGTTGCTGGG - Intronic
954532107 3:51330050-51330072 CTGTGGTGGGTGAGGATGGTGGG - Intronic
955325480 3:58006866-58006888 GTGGGGAGGTTGAAGCTGCAGGG + Intergenic
955650028 3:61184181-61184203 GAGAGGTGTGTGAATCTGCTTGG - Intronic
956537752 3:70296989-70297011 GTGTGGTGGGGGAGGCGGTTGGG - Intergenic
956917915 3:73892999-73893021 ATATGGTGGGTGATGCAGCTAGG - Intergenic
958930766 3:100205351-100205373 GTGAGATGTGTGAAGCTGCCAGG - Intergenic
959009874 3:101062402-101062424 GTGCAGTGGCTGAAGCTCCTGGG + Intergenic
961087702 3:124083323-124083345 ATGTGGTGGGTGCAGATGCAGGG + Intronic
961525648 3:127495663-127495685 ATGTGGTGTGTGCAGCTGCTGGG - Intergenic
965191540 3:165536402-165536424 GTGTGGTGGCTGAAAATGGTTGG + Intergenic
965562741 3:170077428-170077450 GAGTGGTGGGAGAAACTGTTGGG + Intronic
967158858 3:186717943-186717965 GGGTGGTGGGTGATGGTGGTGGG - Intronic
967158879 3:186718003-186718025 GGGTGGTGGGTGATGGTGGTGGG - Intronic
967158892 3:186718046-186718068 GGGTGGTGGGTGATGGTGGTGGG - Intronic
967158956 3:186718228-186718250 GGGTGGTGGGTGATGGTGGTGGG - Intronic
967319860 3:188184579-188184601 GTGTGGTGGGAAAAGCAGGTCGG + Intronic
967870274 3:194223952-194223974 GAGTGGTGGGGGGAGATGCTGGG - Intergenic
968536129 4:1130894-1130916 GCGTGGTGAGAGAGGCTGCTAGG + Intergenic
968553303 4:1235175-1235197 CTATGGTGAGTTAAGCTGCTAGG + Intronic
969632258 4:8345613-8345635 TTGGGGAGGGTGCAGCTGCTGGG + Intergenic
969843361 4:9900258-9900280 CTTTGGTGAGTGAAGCTGGTGGG + Intronic
970727547 4:19064196-19064218 GGGTGGTGGGAGAAGCTGTAAGG - Intergenic
974640664 4:64625549-64625571 GAGTGGTGGGAGAAGCTACAGGG - Intergenic
981300288 4:143179029-143179051 GGTTTGTGGATGAAGCTGCTAGG - Intergenic
981698153 4:147579894-147579916 GTGTGGTGGGTGGAGGTGAGAGG - Intergenic
982436554 4:155387608-155387630 GTGTGGTGGGAGGAGCTGGGTGG - Intergenic
982805208 4:159754942-159754964 CTGTGATGGGAGAAGCTGCCTGG - Intergenic
983322284 4:166210895-166210917 GTGTGGTGGGAGAGACTTCTGGG - Intergenic
986322079 5:6640110-6640132 GTGTGGTGGCTGGAGCACCTGGG + Intronic
986365964 5:7032012-7032034 GTGTGGTGGGGGAAGAAGCAAGG - Intergenic
986482351 5:8202238-8202260 GTGTTCTGGGTCCAGCTGCTTGG + Intergenic
992890154 5:81196599-81196621 GTGGGGTGGGGGACGCTTCTGGG - Intronic
996876179 5:128243050-128243072 GTTTGGTGGGTGCAGCTGACTGG + Intergenic
998127331 5:139633508-139633530 GTGTGGTCAGTGAATCTGCATGG + Intergenic
999060114 5:148624719-148624741 GTGTTGTGGGTGAAGTTTCAGGG + Intronic
1000192610 5:158925777-158925799 GTGTGGTGGGTGGAGATGAGTGG + Intronic
1000302076 5:159965463-159965485 GTGTGGTGGGTGAAGCTGCTGGG - Intronic
1001283773 5:170407310-170407332 CTAAGGTGGGTGCAGCTGCTGGG + Intronic
1001772926 5:174309332-174309354 GTGATGTGGGGGAAGCTACTAGG - Intergenic
1002576567 5:180177321-180177343 GTGTCTTTGGGGAAGCTGCTGGG - Intronic
1003891293 6:10565977-10565999 CTGTGTTTGGTGAAGGTGCTGGG - Intronic
1006044914 6:31287099-31287121 ATGTGCTGTGTGAAGCTGCCTGG - Intronic
1007013794 6:38442565-38442587 GTGGACTGGGTGAAGCTTCTGGG - Intronic
1008977572 6:57445922-57445944 CTGTGGTGTGTCAGGCTGCTGGG - Intronic
1009165713 6:60338876-60338898 CTGTGGTGTGTCAGGCTGCTGGG - Intergenic
1010823944 6:80450420-80450442 GTCTGGTGGGTAATGGTGCTAGG - Intergenic
1011358596 6:86498274-86498296 GTGTGGTGGGAGAAGGTACAAGG - Intergenic
1011734072 6:90295611-90295633 GTCTCCTGGGTGAAGCTTCTGGG + Intronic
1014629340 6:123770305-123770327 GTTTGGTGGGTGCTGCTGATTGG + Intergenic
1016728993 6:147407336-147407358 GAGCTGTGGGTGTAGCTGCTGGG - Intergenic
1017281303 6:152629153-152629175 GTGGGGTGGGTGAAGCAGAGTGG + Intronic
1017435466 6:154411506-154411528 GTGTGGTGGCAGGAGCTACTTGG + Intronic
1017768079 6:157623225-157623247 GTGTGGTGGGAGGAGCTGGTGGG + Intronic
1018644678 6:165936571-165936593 GTGTGGTGAGGGGAGCTGCCAGG + Intronic
1018828202 6:167423424-167423446 GTGTGGTGGGGGGAGCCGCCGGG - Intergenic
1018828230 6:167423507-167423529 GTGTGGTGGGGGGAGCCGCCGGG - Intergenic
1018828258 6:167423586-167423608 GTGTGGTGGGGGGAGCCGCCAGG - Intergenic
1018828283 6:167423667-167423689 GTGTGGTGGGGGGAGCCGCCGGG - Intergenic
1018828309 6:167423748-167423770 GTGTGGTGGGGGGAGCCGCCGGG - Intergenic
1018828335 6:167423829-167423851 GTGTGGTGGGGGGAGCCGCCAGG - Intergenic
1018828360 6:167423910-167423932 GTGTGGTGGGGGGAGCCGCCGGG - Intergenic
1018828388 6:167423991-167424013 GTGTGGTGGGGGGAGCCGCCGGG - Intergenic
1019299750 7:297045-297067 GGGTGGTGGGAGGAGGTGCTGGG + Intergenic
1019299804 7:297228-297250 GGGTGGTGGGAGGAGGTGCTGGG + Intergenic
1019299841 7:297350-297372 GGGTGGTGGGAGGAGGTGCTGGG + Intergenic
1019359734 7:598582-598604 GTGTGGAGGGTGATGGTGTTTGG - Intronic
1020040680 7:4998544-4998566 ATGTGGTGGGTGATGGTGCTGGG + Intronic
1021124546 7:16836343-16836365 GTGGGCTAGGTGAACCTGCTGGG - Intergenic
1022194573 7:28051656-28051678 GTGTGATGGGTGAGGCTTGTTGG - Intronic
1022776628 7:33533583-33533605 ATCTGGTGGGTAAAGCTGCTAGG - Intronic
1024244031 7:47455920-47455942 GTGTGGTGGGTGGGGCAGCCAGG + Intronic
1026805640 7:73428583-73428605 GTGTGTCGGGTGGACCTGCTGGG + Intergenic
1026824823 7:73574963-73574985 CTGGGTTGGGTGATGCTGCTGGG + Intronic
1030848917 7:114458671-114458693 GTGTGGTGGATCATGCTACTTGG - Intronic
1030850926 7:114486379-114486401 GTGTTGTGGGAGAAACTGGTGGG - Intronic
1030929617 7:115505959-115505981 GTTTTGTTGGTGAAGCTTCTTGG - Intergenic
1031086338 7:117305079-117305101 CTGTGGTAGGTGAATCTGCCTGG + Intronic
1033254497 7:139788568-139788590 GTTTGATGGGTGCAGCTGCATGG - Intronic
1033601421 7:142891661-142891683 GTGTGGAGTGTGAAGCTCCTTGG - Intergenic
1033781808 7:144680139-144680161 GTGTGGCAGGTGAGGCTGTTGGG - Intronic
1033884308 7:145926877-145926899 GTGTACTGGGAGAAGCTGATGGG - Intergenic
1035010974 7:155714704-155714726 GTGTGGTGGATGCTGCTGATGGG + Intronic
1035373468 7:158393427-158393449 GTGTGGAGGCTGAAGTTGCCCGG - Intronic
1036674492 8:10818746-10818768 GTGGGGTGGGGGCAGCTGTTGGG + Intronic
1037666169 8:20972125-20972147 GTGAGGTGGATGAAGCTGGAGGG - Intergenic
1037822193 8:22140418-22140440 ATCTGGTGGGTGAAGCTTGTTGG - Intronic
1038145636 8:24892847-24892869 GTCTGGTAGGTGAATCTGGTGGG + Intergenic
1042221987 8:66483273-66483295 ATGTGGTGGAGGAAGTTGCTGGG - Intronic
1042766781 8:72330889-72330911 GTGTGCTGTGTTAAGCTGTTAGG - Intergenic
1046734129 8:117757869-117757891 ATGCTGTGGGTGAAGCTCCTTGG + Intergenic
1047346182 8:124031091-124031113 CTGTGGTTGGTGAAGCTTCAGGG + Intronic
1048356917 8:133661394-133661416 GTGTTGTGGGTGATCCTGCTTGG + Intergenic
1048970211 8:139641244-139641266 GGGTGCTGGGTGCAGCTGCAAGG - Intronic
1049008704 8:139873425-139873447 GAGGGGTGGGGGAAGGTGCTGGG - Intronic
1049275364 8:141717579-141717601 GTGTTGTGGGTGGAGCTGCGTGG - Intergenic
1049824675 8:144661149-144661171 CCGGAGTGGGTGAAGCTGCTGGG - Intergenic
1050055777 9:1652456-1652478 GTGTGGAGGTTGGAGCTGCCTGG + Intergenic
1051120801 9:13750128-13750150 ATGTGGTGAGTTAAGCTGTTTGG + Intergenic
1051507773 9:17844558-17844580 GGGTGGTGGGTGGTGCTGCAGGG + Intergenic
1054929731 9:70623553-70623575 CAGTGGTGAGTAAAGCTGCTGGG + Intronic
1055535129 9:77233741-77233763 TTGTGGTTGGAGAAGATGCTTGG + Intronic
1057140732 9:92725438-92725460 GTGTGCTGGATGGAGGTGCTAGG - Intronic
1057704626 9:97388151-97388173 GTGGGGTGGGAGAAACTCCTGGG - Intergenic
1058038927 9:100283176-100283198 GTGTGGTGGGGCATGCTACTCGG + Intronic
1059045418 9:110861518-110861540 CTGTGATGGGAGGAGCTGCTGGG - Intergenic
1060451614 9:123747179-123747201 GTGTGGTGGGAGAAGAAGTTGGG - Intronic
1060970021 9:127732516-127732538 GGGTGTGGGGTGAAGCTGCCCGG + Intronic
1061255991 9:129454347-129454369 AGGTGGTGGGTGAAGGTGGTGGG + Intergenic
1061379098 9:130243645-130243667 GTCTGGAGGGAGAAGCAGCTCGG + Intergenic
1062282736 9:135759240-135759262 GTGTGGTGGGTAAAGGGGCAAGG + Intronic
1062441407 9:136571351-136571373 GTGTGGTGGCTGAGGCCGCCTGG - Intergenic
1062522196 9:136962745-136962767 CTGGGGTGGGTGGAGCTGCCTGG - Intergenic
1062667130 9:137680770-137680792 GTGTGGTGTGGGGAGCAGCTCGG - Intronic
1186269770 X:7874037-7874059 TTGTGGTTGGTGCATCTGCTTGG + Intergenic
1187943970 X:24408633-24408655 GTGTGGTGCGTGGTGCTGGTGGG + Intergenic
1192381943 X:70626233-70626255 GTGAGGTGAGTGAAGCACCTAGG + Intronic
1194084637 X:89510386-89510408 CTGTGCTGGGAGGAGCTGCTGGG + Intergenic
1194378408 X:93164212-93164234 ATGTGATGTGTGCAGCTGCTGGG + Intergenic
1197839283 X:130728262-130728284 GGGTACTGGGAGAAGCTGCTGGG - Intronic
1199077926 X:143545312-143545334 CTGTGATGGGAGGAGCTGCTGGG + Intergenic
1199446894 X:147935157-147935179 GTGAGGTGAGAGAAGCTACTTGG - Intronic
1199982694 X:152929475-152929497 GTGTGGTGGGTGGGAGTGCTTGG + Intronic
1201888450 Y:18914491-18914513 AGGTGGTGGGTGGAGCTTCTAGG - Intergenic