ID: 1000302371

View in Genome Browser
Species Human (GRCh38)
Location 5:159967828-159967850
Sequence CTTCTCAAGGCCATGGTCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 0, 2: 3, 3: 18, 4: 188}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000302368_1000302371 -9 Left 1000302368 5:159967814-159967836 CCTTTGGCTGAACACTTCTCAAG 0: 1
1: 0
2: 2
3: 12
4: 196
Right 1000302371 5:159967828-159967850 CTTCTCAAGGCCATGGTCCTTGG 0: 1
1: 0
2: 3
3: 18
4: 188
1000302364_1000302371 -1 Left 1000302364 5:159967806-159967828 CCCCCTCACCTTTGGCTGAACAC 0: 1
1: 0
2: 3
3: 10
4: 145
Right 1000302371 5:159967828-159967850 CTTCTCAAGGCCATGGTCCTTGG 0: 1
1: 0
2: 3
3: 18
4: 188
1000302361_1000302371 21 Left 1000302361 5:159967784-159967806 CCCATGAGAAAAGTTGGCATCAC 0: 1
1: 0
2: 0
3: 20
4: 115
Right 1000302371 5:159967828-159967850 CTTCTCAAGGCCATGGTCCTTGG 0: 1
1: 0
2: 3
3: 18
4: 188
1000302365_1000302371 -2 Left 1000302365 5:159967807-159967829 CCCCTCACCTTTGGCTGAACACT 0: 1
1: 0
2: 1
3: 20
4: 240
Right 1000302371 5:159967828-159967850 CTTCTCAAGGCCATGGTCCTTGG 0: 1
1: 0
2: 3
3: 18
4: 188
1000302362_1000302371 20 Left 1000302362 5:159967785-159967807 CCATGAGAAAAGTTGGCATCACC 0: 1
1: 0
2: 0
3: 10
4: 121
Right 1000302371 5:159967828-159967850 CTTCTCAAGGCCATGGTCCTTGG 0: 1
1: 0
2: 3
3: 18
4: 188
1000302367_1000302371 -4 Left 1000302367 5:159967809-159967831 CCTCACCTTTGGCTGAACACTTC 0: 1
1: 0
2: 0
3: 11
4: 169
Right 1000302371 5:159967828-159967850 CTTCTCAAGGCCATGGTCCTTGG 0: 1
1: 0
2: 3
3: 18
4: 188
1000302366_1000302371 -3 Left 1000302366 5:159967808-159967830 CCCTCACCTTTGGCTGAACACTT 0: 1
1: 0
2: 0
3: 21
4: 173
Right 1000302371 5:159967828-159967850 CTTCTCAAGGCCATGGTCCTTGG 0: 1
1: 0
2: 3
3: 18
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000302371 Original CRISPR CTTCTCAAGGCCATGGTCCT TGG Intronic
900610477 1:3542507-3542529 CTCCTCTTGACCATGGTCCTCGG - Intronic
900749660 1:4387394-4387416 CACCTGGAGGCCATGGTCCTAGG + Intergenic
901057678 1:6456296-6456318 CTGCTCAAGGCCACAGTCCTGGG - Intronic
901330880 1:8407553-8407575 CCTCTCAAGGCCCTAGTTCTTGG + Intronic
902476675 1:16692159-16692181 CTGCTCAAGGCCACAGTCCTGGG + Intergenic
903334292 1:22614569-22614591 CTCCTCTAGGCCATGGGCCAGGG + Intergenic
903877647 1:26486471-26486493 GTTTTTAAAGCCATGGTCCTAGG - Intergenic
904635542 1:31878068-31878090 CTTATGAAGGCCACGGTCCTGGG + Intergenic
905651372 1:39659268-39659290 CTTCTCAAGGAGAGGGCCCTTGG + Exonic
909884982 1:80930141-80930163 CTTCTCAAAGCCACTTTCCTTGG - Intergenic
910568146 1:88668288-88668310 GTTCTCAACTCCATGGTCATAGG + Intergenic
912324436 1:108744677-108744699 CTCCTGAAGGCCAGAGTCCTTGG - Intergenic
915280159 1:154816935-154816957 TGTCTCAAGGACAGGGTCCTGGG - Intronic
916826446 1:168446278-168446300 CTTCTCCAGGCCATCTTCCAGGG + Intergenic
917395148 1:174585704-174585726 CTTATCAAGGGCTTGGTCTTTGG - Intronic
917504997 1:175619368-175619390 CTGCTCTGGGCCATTGTCCTGGG - Intronic
920341194 1:205276173-205276195 CGCCTCCAGCCCATGGTCCTGGG + Intergenic
920441895 1:205986226-205986248 CTTCCCCAGGGCAGGGTCCTAGG + Intronic
921556710 1:216607226-216607248 TTTCTCCAGGCCAGGGTCATGGG - Intronic
922804285 1:228377619-228377641 CTGCTCAAGGTCGTGGACCTGGG + Exonic
923859373 1:237877554-237877576 CTTGTCATGGCCAAGGTACTTGG + Intergenic
1063739466 10:8801709-8801731 CTTGGTAAGGCAATGGTCCTGGG + Intergenic
1068365888 10:56049586-56049608 CTTGTGAGGGCCAAGGTCCTTGG + Intergenic
1070762236 10:79031225-79031247 CCTCACAATGCCAGGGTCCTAGG + Intergenic
1071565146 10:86667814-86667836 CCTCCCAAAGCCCTGGTCCTGGG - Intergenic
1073104552 10:101024881-101024903 CTTCACATGCCCATGGGCCTGGG + Intronic
1074134069 10:110611803-110611825 CATCACAAGGCCATGCTCCACGG - Intergenic
1076118663 10:127918949-127918971 CATCTCAAAGTCATGGTTCTTGG + Intronic
1076137605 10:128055788-128055810 CTGCTCTAGGCCAGGGTCCATGG + Intronic
1076489465 10:130847681-130847703 CTTCTCAAAGCCCTTGACCTTGG - Intergenic
1076602125 10:131664071-131664093 CTTGTCAAACCCATTGTCCTTGG - Intergenic
1076723027 10:132401010-132401032 CTCCTCCCGGCCATGGTCCCGGG + Intronic
1076746696 10:132518127-132518149 CATGTCCAGGCCGTGGTCCTTGG + Intergenic
1079336355 11:19573967-19573989 CTGCCCCAGGCCATGGTTCTAGG - Intronic
1080316822 11:30959012-30959034 CTTCTCAAGGATAAAGTCCTGGG + Intronic
1081197558 11:40179611-40179633 CTTCTCAAGGGCAGGGCCATAGG + Intronic
1082174607 11:49046627-49046649 ATTCTCAAGGCACTGGTCCAGGG - Intergenic
1083329052 11:61888717-61888739 CTCCTCAAGCCCATGGCCCAGGG - Intronic
1084189527 11:67492780-67492802 CTGCTCATGGCCCTTGTCCTCGG + Intronic
1084437335 11:69151587-69151609 GTTCTCATGCCCATTGTCCTTGG + Intergenic
1084577257 11:69997430-69997452 CCTCTCAGAGCCATGGTCCTGGG - Intergenic
1084702396 11:70795958-70795980 TTTATCAAGGACATTGTCCTGGG + Intronic
1086240336 11:84682665-84682687 CATCTCAAGGCCCTAGTCATGGG - Intronic
1086691172 11:89789461-89789483 ATTCTCAAGGCACTGGTCCAGGG + Intergenic
1086714630 11:90050194-90050216 ATTCTCAAGGCACTGGTCCAGGG - Intergenic
1087025258 11:93643369-93643391 CCTCTTAAGGCCATAGACCTGGG + Intergenic
1089253033 11:117178950-117178972 CTTCTCACGGCCCTGGCCCGGGG + Exonic
1089712561 11:120325983-120326005 CTTCTAAAGGCCAGGGTCACTGG - Intronic
1090644137 11:128753881-128753903 CTTGCCAAGGGCATGGTCTTGGG + Intronic
1095913372 12:47451384-47451406 CGTCTCAAGACTATGGTCTTCGG + Intergenic
1096423282 12:51478871-51478893 GGTCTCCAGGCCATGGGCCTTGG - Intronic
1097809028 12:63998496-63998518 CTTTTTAATGCCATGGTCCCAGG - Intronic
1098321412 12:69247980-69248002 CTAATTAAGACCATGGTCCTGGG - Intronic
1101131301 12:101693897-101693919 CTTCTGAAGGCCATGATCAAAGG - Intergenic
1102009403 12:109608798-109608820 CAACTCAAGGCCCTGGCCCTGGG + Intergenic
1102045380 12:109826665-109826687 CTTCTCAACGCCATATCCCTTGG + Intronic
1103131788 12:118475458-118475480 CTGCTCAGGGTCATGTTCCTAGG - Intergenic
1104217251 12:126746298-126746320 TTCCTGAAGGCCCTGGTCCTAGG + Intergenic
1104690679 12:130823676-130823698 CTTCTCCAGGCCCTGGAACTAGG + Intronic
1105018216 12:132798989-132799011 CTCCTCAGGGCCATGGTCCTGGG - Intronic
1108594245 13:51936414-51936436 CTTTTCATTGCCATGTTCCTGGG + Intronic
1112729499 13:102344690-102344712 CCTCTCAAGGACAAGGTCCAGGG + Intronic
1118485834 14:66213767-66213789 CTTGTGAAGGCCAAGGCCCTTGG - Intergenic
1119368114 14:74112978-74113000 TTTCTCAATTCAATGGTCCTAGG - Intronic
1120922998 14:89772120-89772142 CTTCTCAAAGCCATCTTCCCTGG + Intergenic
1122308196 14:100778681-100778703 CTTTCCAAGGGCATGGGCCTGGG + Intergenic
1122372465 14:101236172-101236194 CCTCTCAGGGCCATGGTGATGGG + Intergenic
1124028554 15:25989265-25989287 CTTCTCAAGGCCGCTCTCCTTGG + Intergenic
1125577893 15:40767593-40767615 CTTGTGTAGGCCATGTTCCTCGG + Exonic
1128866801 15:71120463-71120485 CTTCTCTAGGGCGTGGTCCGAGG + Intronic
1128896774 15:71381029-71381051 CTTGTCAAGCCCATAATCCTAGG - Intronic
1130299019 15:82666219-82666241 CATCTCAAGGCCGTTGTCTTGGG + Intronic
1141216172 16:82025879-82025901 CTTCTCAAGACCATAGAACTGGG + Intergenic
1141308675 16:82891669-82891691 CTGCTCAATGCCATGGTCACTGG - Intronic
1141461143 16:84179485-84179507 CTCCGCAAGGCCATGGCCCGAGG - Exonic
1141586639 16:85038186-85038208 CTCTTCAAGGGCATGGACCTGGG - Intronic
1141984818 16:87572841-87572863 CTTCTCAGGGGCATCTTCCTGGG - Intergenic
1142358964 16:89617308-89617330 CCTCTCAGGGCCCTGGGCCTTGG - Intronic
1143391145 17:6560009-6560031 TTTGTCAAGGCCATGGTGATTGG - Intergenic
1143876714 17:9997098-9997120 CTTCTCAAGGCAATGGTGAAAGG + Intronic
1144834462 17:18149668-18149690 CTTCTCACAGCCAGGGTCATGGG + Intronic
1147927776 17:43955873-43955895 CTTCTCTAGGCCCTGATCCCTGG - Intronic
1148105080 17:45114663-45114685 CTTCTCCAGGCCAAGGCCCCAGG + Intronic
1150216975 17:63476589-63476611 CTTCACCAGGCCATGGTCGAGGG - Intergenic
1155160354 18:23190350-23190372 CTACTAGAAGCCATGGTCCTTGG + Intronic
1156992940 18:43431928-43431950 CTTGTGAAGGCCATGGTTGTTGG - Intergenic
1158210335 18:55041992-55042014 CTTCTCAAGGACACTGTCCCTGG - Intergenic
1158318224 18:56235586-56235608 CTTCTGGAGGCCATGCCCCTTGG + Intergenic
1159599137 18:70411822-70411844 CTTCTCAAGACCATGGGCTGCGG + Intergenic
1160947340 19:1649901-1649923 GTCCTCAGGGGCATGGTCCTGGG - Intronic
1165225421 19:34351406-34351428 CATCTCCAGGCCCTGGTTCTAGG - Intronic
1166411735 19:42560135-42560157 CTTCTCAAGGTCATGTCCATAGG + Intronic
1168121001 19:54252488-54252510 CTTCTGCAGGCCCTGGTCCTTGG + Exonic
1202710696 1_KI270714v1_random:18000-18022 CTGCTCAAGGCCACAGTCCTGGG + Intergenic
926130093 2:10297504-10297526 AATCTCAAGGCCGGGGTCCTGGG - Intergenic
928195896 2:29216210-29216232 CTTCTCATGGCCATGGTCGTGGG + Intronic
932446452 2:71784752-71784774 CTTCCCAAGGCCAAAGTCCTTGG + Intergenic
934929704 2:98411639-98411661 GTTCTCAAAGCCATGTTCCATGG + Intergenic
935201937 2:100864563-100864585 TTTTTCAATGCCATGTTCCTTGG - Intronic
935682268 2:105648147-105648169 CCTCTCAAGGACATTGGCCTTGG - Intergenic
936079482 2:109422683-109422705 CTCCTAGAGGCCATGCTCCTGGG + Intronic
936401404 2:112167288-112167310 CTTCTCACGACTATGTTCCTGGG - Intronic
936855772 2:116955559-116955581 CTTCTGAATGCCATTATCCTAGG + Intergenic
938588796 2:132717513-132717535 CTTCTCAAGGCCAAGGACTTTGG - Intronic
946057184 2:216912474-216912496 CTTCTCCAGCACATGGTCCTGGG + Intergenic
946456692 2:219832251-219832273 CTTCTCAAGGCCTGGCTCTTTGG - Intergenic
946778196 2:223165908-223165930 CTACTCAAGGCCAAAGTCCCTGG - Intronic
1169850125 20:10039249-10039271 CATCTCAAGACCATGGTCTGAGG + Intronic
1170902898 20:20483466-20483488 CTTCTCAGGGCGACTGTCCTTGG - Intronic
1171819825 20:29824596-29824618 CTTCTGGAGGCCATTATCCTAGG - Intergenic
1173392566 20:42648120-42648142 CTTCTAAAGACCCTGGGCCTTGG + Intronic
1176009680 20:62886188-62886210 CGTCTCCAGGCCCTGGTCCCTGG - Intronic
1176120464 20:63452270-63452292 CTTCTCAATGGCATGGAGCTGGG - Intronic
1176150579 20:63588842-63588864 CCCCTCCAGGCCAGGGTCCTGGG - Exonic
1180152758 21:45960164-45960186 CTTGGCAAGGGCAGGGTCCTGGG - Intergenic
1180707092 22:17816714-17816736 CTTCTCAAGGACATCGTCGCTGG + Exonic
1181489909 22:23255196-23255218 TTTCTGAAGGCCTTGGTGCTGGG + Intronic
1183265098 22:36819973-36819995 CTGCTCAAAGCCACGGGCCTGGG + Intergenic
1184028383 22:41875545-41875567 CTTCTAAAGGGCATCGACCTAGG + Exonic
1184209885 22:43029205-43029227 CTTCTCAGGGCCACGGAGCTTGG + Intergenic
949647036 3:6107328-6107350 CTTCTGATGTCCATGGACCTGGG - Intergenic
950484705 3:13266278-13266300 CATCTCAATGCCATCGCCCTTGG + Intergenic
954526605 3:51277437-51277459 CCTGTCAAAGCCATTGTCCTGGG + Intronic
954925611 3:54231760-54231782 CTTGTCAAGGCCAAGGTTATTGG + Intronic
955561261 3:60193586-60193608 CTTGTCAAGGCCATGGTTATAGG - Intronic
959837947 3:110942985-110943007 CCTGTCAAGACCATGGTCCCTGG - Intergenic
960955292 3:123027136-123027158 CTTCTCCAGGCCTGGGTCCCGGG + Intronic
961137499 3:124525608-124525630 TTTCTCAAGGCCAAGATCCCAGG - Intronic
961819786 3:129570137-129570159 CTTGTCAAGCCCTTGGTCCTGGG + Intronic
965517607 3:169638428-169638450 CTTCTCAGGGTCATGGTGCATGG - Intronic
965681464 3:171256290-171256312 TTTCTCTAGGCCCTGGGCCTTGG - Intronic
966252551 3:177882736-177882758 CTTCCCAAGGCAATGGTTATGGG - Intergenic
969042946 4:4315187-4315209 CCTCTCAAGGTCATCCTCCTTGG + Intronic
969278076 4:6150414-6150436 CTTCTCAAGGACAGTGTCCACGG + Intronic
970477242 4:16436078-16436100 CTTCCCAAGGTCATGACCCTGGG - Intergenic
971344037 4:25796172-25796194 CTTCTCTGGGGCTTGGTCCTGGG - Intronic
972740470 4:41882103-41882125 GTTCTCCGGGCCAGGGTCCTCGG + Intergenic
973680641 4:53315334-53315356 CTCCTCAGGGTCATGTTCCTAGG - Intronic
974158302 4:58102945-58102967 CTTCTCATGTGCAGGGTCCTGGG + Intergenic
975176078 4:71290488-71290510 CTTCTCAAGGGAAAGGTCTTTGG + Intronic
981011894 4:139933574-139933596 CTTCTCAAGGCCTACATCCTGGG + Intronic
981578058 4:146225597-146225619 CTTCTCCAGGCCATGGTCTCAGG - Intronic
984697173 4:182790850-182790872 CTTCTCAATGATATGCTCCTGGG - Intronic
985424506 4:189815888-189815910 TTTCTCAAGGCAATGAGCCTGGG + Intergenic
985553739 5:546148-546170 CTTCTCAAGGCCAGCGTCCAAGG + Intergenic
986733550 5:10652257-10652279 GTTCTCAAGGCCCTGGTCCGGGG + Intergenic
992763991 5:79978115-79978137 TCTCTCAATGCCATGGTCCAAGG + Intronic
992779985 5:80119004-80119026 CTTCTAAAGTCCATGTTCTTAGG - Intronic
993005457 5:82424281-82424303 CTTCCCAAGGCCAAAGTCCCTGG + Intergenic
994977437 5:106828339-106828361 CTCTTCAAGGCAATGGTGCTGGG - Intergenic
997409281 5:133678810-133678832 CTTCTCCAGGCCTTAATCCTGGG - Intergenic
997603733 5:135157648-135157670 CTACTCAAGGCCATGGTGCTGGG + Intronic
998312826 5:141152067-141152089 CTGCTCAAGGCCACGGAGCTCGG + Exonic
998319516 5:141215939-141215961 CTGCTCAAGGCCACGGAGCTCGG + Exonic
998453206 5:142250540-142250562 CTTTTCAAGTCTATGGGCCTTGG - Intergenic
999434532 5:151553067-151553089 CTTCTCAAGGTCGGGCTCCTCGG - Intronic
1000302371 5:159967828-159967850 CTTCTCAAGGCCATGGTCCTTGG + Intronic
1000302604 5:159969643-159969665 CTTCCCAAGGGCCTGGTCTTTGG - Intronic
1000501177 5:162052851-162052873 CTTTTCTAGGCCCTGGACCTTGG - Intergenic
1001797924 5:174517763-174517785 CTTCTCAATGCCATGCTTCAGGG - Intergenic
1001998388 5:176180528-176180550 CCTCTCAAGGTCATGTTGCTAGG + Intergenic
1002021950 5:176369058-176369080 CCTCTCCAGGCCATGGGCCCAGG - Intronic
1004697635 6:18048542-18048564 CTTCTCAAGGTCATGTCCCAGGG + Intergenic
1005405343 6:25481492-25481514 CTTCTCAAGAACATGCCCCTGGG + Intronic
1006375363 6:33668831-33668853 CATCTCAAGGGCAGGGTCCGTGG - Intronic
1007973770 6:46079596-46079618 ATTCATAATGCCATGGTCCTTGG - Intronic
1008878035 6:56350766-56350788 CTTCTCTAGTCCAAGGCCCTAGG - Intronic
1013318964 6:108967939-108967961 CTTCTCAAGCCCACAGTCGTAGG + Intronic
1018385615 6:163300329-163300351 CTCTTCAGCGCCATGGTCCTAGG - Intronic
1018626205 6:165781227-165781249 CAGCTCAAGGCCATGGCCCTTGG - Intronic
1023043625 7:36193617-36193639 CATCTGAAGGCCGTGGTCCCTGG - Intronic
1023607165 7:41941513-41941535 CTTCTCAATGCCCTGCACCTGGG + Intergenic
1024107806 7:46110435-46110457 GTTAGCAAGGCCATGCTCCTGGG + Intergenic
1028168063 7:87562336-87562358 CTTCTCAAAGCAATCTTCCTGGG + Intronic
1029357822 7:100065790-100065812 CTTCTCAGGGACATGGCCATAGG + Intronic
1030566327 7:111162891-111162913 CTGCTCAAGGCCACAGCCCTAGG + Intronic
1032462370 7:132121681-132121703 CTGCTCAAGGTCATGGTGGTTGG + Intergenic
1032671459 7:134086598-134086620 CCTCTCAAGGCAGTGGTTCTGGG + Intergenic
1032850587 7:135791725-135791747 CTTCTCTAGGCCATGCTGCAGGG - Intergenic
1033111570 7:138583125-138583147 CTGCTCAGTGTCATGGTCCTGGG - Intronic
1035038817 7:155912907-155912929 ATTCTCAAGGACATGGTCTATGG + Intergenic
1037617913 8:20536294-20536316 TTTCTCATGCCCATGGACCTTGG + Intergenic
1038852883 8:31297277-31297299 CTTCTCAATGCCAGCTTCCTGGG - Intergenic
1039254428 8:35703533-35703555 TGTCTCAAGTCCATGGCCCTGGG + Intronic
1041009315 8:53525802-53525824 CTTCTGAAGCCCATGGTTCAAGG + Intergenic
1041873530 8:62661855-62661877 CTTAGCCAGGCCATGTTCCTGGG + Intronic
1043955446 8:86353768-86353790 CTTCTCATGGCCAGGTGCCTTGG - Intronic
1046031708 8:108789886-108789908 TTTCTCATGGCCATAGTTCTGGG + Intergenic
1048366154 8:133740390-133740412 CTTCTCATGGCCCAGTTCCTGGG - Intergenic
1050737816 9:8784467-8784489 CTTCTCTATGCCAGGATCCTTGG - Intronic
1051372749 9:16372319-16372341 GTTCTCAAGGCTATGGGCCCTGG - Intergenic
1052841437 9:33294681-33294703 ATTCTGAAGGCCATGGCTCTTGG - Exonic
1059038827 9:110789997-110790019 ATGCTCCAGGCCTTGGTCCTTGG - Intronic
1061979846 9:134095827-134095849 CTTCTTAATGCCATCGTCTTGGG - Intergenic
1062316886 9:135971745-135971767 TTTCTCAAGGCCATGGGGGTGGG + Intergenic
1186124396 X:6397352-6397374 CGTCTCAAAGCCATTGTCTTAGG - Intergenic
1186338941 X:8622678-8622700 CTTCTCAAGTCCACTGTCCTTGG + Intronic
1187577197 X:20569861-20569883 CTTCTGAAGACTATGTTCCTGGG - Intergenic
1192025161 X:67442364-67442386 TTTCACAGGGCCATGATCCTAGG + Intergenic
1192232309 X:69273951-69273973 CTTCTCTACGCCAGGGCCCTAGG - Intergenic
1193481270 X:82032232-82032254 CTTCTCAAGCCCCACGTCCTGGG - Intergenic
1194604643 X:95963945-95963967 TTTCACAAGGCCTTGGTCATGGG + Intergenic
1195139716 X:101947215-101947237 CTGCTCAATGCCAAAGTCCTTGG + Intergenic
1195708368 X:107754693-107754715 CTTCTCTATTCCATGGTCATTGG + Intronic
1198991365 X:142518349-142518371 TATATCAAGGCCATTGTCCTTGG + Intergenic
1200002435 X:153068945-153068967 CTTCTCATCTCCGTGGTCCTTGG - Intergenic
1200005289 X:153081065-153081087 CTTCTCATCTCCGTGGTCCTTGG + Intergenic
1201066846 Y:10105266-10105288 CTTCTGGAGGCCATTATCCTAGG + Intergenic
1201605765 Y:15782745-15782767 CATCTCAATGCCATTGTCCTAGG - Intergenic
1202088849 Y:21166835-21166857 CTTCTCAAGGTAATGGGCCTTGG + Intergenic