ID: 1000302912

View in Genome Browser
Species Human (GRCh38)
Location 5:159972177-159972199
Sequence CAGCCAGCGGACCCTGCCCT CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 355
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 334}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000302912 Original CRISPR CAGCCAGCGGACCCTGCCCT CGG Exonic
900161964 1:1228116-1228138 CAGCCTGCGGAGGCTGCCCGTGG + Intronic
900647282 1:3714674-3714696 CGGGCAGAGGACCCTGCGCTTGG + Intronic
900952373 1:5865261-5865283 CAGCCAGCGATCCCTGCAGTGGG + Exonic
901553963 1:10017104-10017126 GAGCCACCGCACCCAGCCCTGGG + Intergenic
901634539 1:10664447-10664469 CAGCCAGGGGACCGTGGCCGGGG + Intronic
901658468 1:10784135-10784157 CAGCCATCTCACCCTGCCCTGGG + Intronic
901934644 1:12619016-12619038 CAGCCAGCGTCTCCTGTCCTTGG + Intergenic
902073425 1:13762515-13762537 CAGCCATTGGACGCTGGCCTAGG + Intronic
903455082 1:23482014-23482036 CAGGCAGTGGACTCTGCCCAAGG + Intronic
903808732 1:26022774-26022796 CAGCCAGCGGGGCCAGCCTTGGG - Exonic
904539771 1:31224933-31224955 AAGCCAGCGGACACTGCACATGG + Intronic
908475445 1:64483548-64483570 CACCCAGCCCAGCCTGCCCTTGG - Intronic
909608658 1:77531700-77531722 CACCCAGTGGATCCTGCACTGGG + Intronic
913212425 1:116592622-116592644 CAGCCAGCCTACCCTCCCTTCGG + Intronic
916219944 1:162433576-162433598 CATCCAGTGGATCCTGCACTGGG - Intergenic
917798698 1:178551374-178551396 CAGGGAGCTGACCCTGGCCTTGG + Intergenic
918317960 1:183339005-183339027 CTGCCAGGCGACCCTGCCCAAGG + Intronic
919049707 1:192499013-192499035 CACCCAGTGGATCCTGCACTGGG + Intergenic
922481312 1:225941402-225941424 CAGCCAGAGGCCCCAGGCCTGGG - Exonic
924030740 1:239882826-239882848 CAGCCAGTGTGCCCTGCCTTAGG - Intronic
924796247 1:247294508-247294530 CAGACAGAGGTCTCTGCCCTTGG + Intergenic
1062858004 10:789162-789184 CAGCCAGCGCCCCCTGGCCCCGG - Intergenic
1064748255 10:18499331-18499353 GAGCCACCGGGCCCAGCCCTAGG - Intronic
1064998413 10:21316148-21316170 CAGCCAGCAGAATCTGTCCTTGG - Intergenic
1066598274 10:37076387-37076409 CACCCAGTGGATCCTGCACTGGG - Intergenic
1067142320 10:43667906-43667928 CCGCCAGCGGGACCTGCCGTAGG - Intergenic
1067796499 10:49325660-49325682 CTGCCAGGGGGCCCTGCTCTGGG - Exonic
1069566355 10:69465975-69465997 GAGCCTGTGGCCCCTGCCCTGGG - Intronic
1069639135 10:69943776-69943798 CAGCCCCCGGCCCCTGCCCCGGG + Intronic
1071085276 10:81862621-81862643 CACCCAGTGGATCCTGCACTGGG + Intergenic
1071574685 10:86716622-86716644 CAGCAAGCAGACCCTGCCCCGGG + Exonic
1073183719 10:101602496-101602518 CAGCCAGCAGCCCCTGCAGTGGG + Intronic
1073331071 10:102670022-102670044 GATCCAGAAGACCCTGCCCTGGG - Intergenic
1073332804 10:102681687-102681709 AAGCCAGCAGATCGTGCCCTGGG - Intronic
1073333722 10:102688785-102688807 GAGCCACCGCACCCAGCCCTTGG + Intronic
1075643715 10:124084175-124084197 CAGCGCGTGGCCCCTGCCCTTGG - Intronic
1076187853 10:128462757-128462779 CTGCCAGTGGAGCCTGACCTTGG + Intergenic
1076227620 10:128792909-128792931 CAGCCAGTGGTCCCTGGCCATGG - Intergenic
1076765933 10:132633067-132633089 CACCCAGGAGCCCCTGCCCTGGG - Intronic
1076863981 10:133158526-133158548 GAGCCTGCGGCCCCTGCCCGAGG + Intergenic
1076899265 10:133329077-133329099 AAGCCAGAGGACCCTGAGCTGGG + Intronic
1077390606 11:2299135-2299157 CACCCAGCTGACCCAGGCCTAGG + Intronic
1080204503 11:29713078-29713100 CACCCAGTGGATCCTGCACTGGG - Intergenic
1081136082 11:39442021-39442043 CAGCTAGTGGATCCTGCACTGGG + Intergenic
1082272198 11:50183698-50183720 CACCCAGTGGATCCCGCCCTGGG - Intergenic
1083292815 11:61699316-61699338 CAGCCAGGTGAGCATGCCCTGGG + Intronic
1084028479 11:66467128-66467150 CAGCCACCGGCGCCCGCCCTCGG - Intronic
1084541922 11:69792380-69792402 CAGGCAGCAGGTCCTGCCCTGGG + Intergenic
1084951429 11:72668270-72668292 CAGCCAGTGGAGCCAGACCTGGG - Intronic
1089429505 11:118410926-118410948 GAGCCACTGCACCCTGCCCTGGG - Intronic
1090040713 11:123288766-123288788 GAGCCACCGCACCCGGCCCTGGG + Intergenic
1091751252 12:3022496-3022518 CACCCAGCTGACTCTGCCCCAGG + Intronic
1093077598 12:14773908-14773930 CAGTCCACGGACCCTGTCCTGGG + Intergenic
1095581576 12:43806283-43806305 CAGCCAGCGGCCCCGGCCGGCGG + Intronic
1097213006 12:57386693-57386715 CACCCAGTGGATCCTGCACTGGG - Intronic
1101353651 12:103956729-103956751 CAGCCTGCCGACCATGCCCGCGG - Exonic
1101842637 12:108339388-108339410 CAGCTAGCCGCCCCCGCCCTAGG - Intergenic
1103911079 12:124352735-124352757 CAGCCGGTGGCCCCTGCTCTTGG + Intronic
1104938413 12:132379837-132379859 CAGCAAGCGGACTCTGCTCGGGG - Intergenic
1105777926 13:23680204-23680226 CATCCAATGGGCCCTGCCCTGGG + Intergenic
1106037036 13:26052172-26052194 CAGCAGGCAGACCCCGCCCTTGG - Intergenic
1108435424 13:50397013-50397035 CACCCAGTGGATCCTGCACTGGG - Intronic
1111441982 13:88292244-88292266 CACCCAGTGGATCCTGCACTGGG - Intergenic
1113696354 13:112348826-112348848 CAGCCAGTGGCACCTGCCCCAGG - Intergenic
1115268550 14:31527020-31527042 CACCTAGTGGATCCTGCCCTGGG + Intronic
1116803464 14:49467352-49467374 CAGCAAGACGACCCTGTCCTGGG - Intergenic
1117082580 14:52166845-52166867 CAGCCAGCGCTGCCGGCCCTGGG + Intergenic
1117573080 14:57068822-57068844 CAGCCAGGGGCTCCTCCCCTGGG + Intergenic
1117825380 14:59696577-59696599 CAGCCTGCCAGCCCTGCCCTTGG - Intronic
1118257815 14:64220550-64220572 CCGCCAGCTGAGCCTGCTCTGGG + Exonic
1121466253 14:94117120-94117142 AACCCTGCGCACCCTGCCCTGGG + Intergenic
1121781113 14:96623193-96623215 CAGTCAGCTGCCCCTGCCGTGGG - Intergenic
1122090625 14:99336522-99336544 GAGCCACCGCACCCAGCCCTGGG + Intergenic
1122417738 14:101558321-101558343 CACCCAGAGGTCCCGGCCCTCGG - Intergenic
1122544969 14:102517117-102517139 CAGCCCGCGAACCCCGCCCCCGG - Intergenic
1122745687 14:103896044-103896066 CAGCCACCGCACCCGGCCCAGGG + Intergenic
1122887627 14:104717374-104717396 CCCACAGCGGACCCTGCCCGGGG - Intronic
1123170768 14:106370896-106370918 CATCCAGTGGCACCTGCCCTGGG - Intergenic
1123194433 14:106603137-106603159 CATCCAGTGGCACCTGCCCTGGG - Intergenic
1123222389 14:106869470-106869492 CATCCAGTGGCACCTGCCCTGGG - Intergenic
1123670824 15:22655278-22655300 GAGCCACCGCGCCCTGCCCTGGG - Intergenic
1124036434 15:26057297-26057319 CACCCAGTGGATCCTGCACTGGG - Intergenic
1125836844 15:42759406-42759428 CAGCCTGCTGAGCCTGCCCCTGG + Intronic
1127772486 15:62242999-62243021 CTGCCAGCCCACCCTGCCCAAGG + Intergenic
1128632534 15:69280900-69280922 CAGCCAGTGGGCCCTGGCCAGGG + Intergenic
1129825127 15:78629873-78629895 CAGCCACAGGACGCTGCCGTTGG + Exonic
1130398837 15:83530126-83530148 CAACCAGGGCATCCTGCCCTGGG - Intronic
1131441666 15:92464286-92464308 CAGCCCGCATACCATGCCCTTGG + Exonic
1132142853 15:99409350-99409372 CAGCCACCGTGCCCGGCCCTGGG - Intergenic
1132870566 16:2114026-2114048 CAGCCAGCAGGACCTGCCCGGGG + Intronic
1133050685 16:3115715-3115737 GAGCCATCCGACCCTGTCCTTGG + Intronic
1133212996 16:4273405-4273427 GAGCGCGCGGACCCTGCTCTGGG - Intergenic
1133307211 16:4817977-4817999 CAGCAAGGGGACTTTGCCCTGGG - Intronic
1134070118 16:11255611-11255633 CTCCCGGCGGACCCGGCCCTAGG + Intronic
1134521966 16:14922878-14922900 CAGCCAGCAGGACCTGCCCGGGG - Intronic
1134709636 16:16321529-16321551 CAGCCAGCAGGACCTGCCCGGGG - Intergenic
1134716849 16:16361558-16361580 CAGCCAGCAGGACCTGCCCGGGG - Intergenic
1134949967 16:18347116-18347138 CAGCCAGCAGGACCTGCCCGGGG + Intergenic
1134957903 16:18390601-18390623 CAGCCAGCAGGACCTGCCCGGGG + Intergenic
1135823425 16:25705002-25705024 GAGCCACCGCACCCGGCCCTGGG + Intronic
1135915739 16:26604046-26604068 CAGGCAGGAGGCCCTGCCCTGGG + Intergenic
1135984701 16:27175591-27175613 AAGCCACCGCACCCAGCCCTTGG + Intergenic
1136619153 16:31416502-31416524 CAGCCTGCAGACCCTGACCGTGG + Exonic
1136716983 16:32289059-32289081 CAGCCAGGGGTCCCCACCCTTGG - Intergenic
1136835360 16:33495304-33495326 CAGCCAGGGGTCCCCACCCTTGG - Intergenic
1139251822 16:65503922-65503944 CAGCTTGCTGGCCCTGCCCTGGG - Intergenic
1140851248 16:78936598-78936620 CAGCCTGTGGACCTTGCCCAGGG - Intronic
1141338899 16:83184468-83184490 GAGCCACCGCACCCTGCCCCTGG - Intronic
1141610829 16:85180267-85180289 CAGCCAGAGGCACCTGCCCCGGG - Intronic
1142272747 16:89099204-89099226 CAGCCAGAGGACACTGCCCACGG - Intronic
1203009443 16_KI270728v1_random:228728-228750 CAGCCAGGGGTCCCCACCCTTGG + Intergenic
1142541718 17:664894-664916 CAGACAGTGAACCCTGGCCTTGG - Intronic
1143095843 17:4477827-4477849 CAGCCAGCGTGCCCAGCCCCAGG - Intronic
1143248539 17:5505241-5505263 CAGGCAGCTGACCCTGCATTGGG - Intronic
1144666392 17:17105172-17105194 CAGGCAGTGCTCCCTGCCCTGGG - Intronic
1145059705 17:19724847-19724869 CTCCCCGTGGACCCTGCCCTCGG + Intergenic
1145900592 17:28488323-28488345 CAGCATGCGGCCCCTTCCCTTGG + Intronic
1146012120 17:29204512-29204534 CAGCCAGCGGCCCCGGCCGGCGG + Intergenic
1146047597 17:29522788-29522810 GAGCCACTGCACCCTGCCCTTGG - Intronic
1148744420 17:49910438-49910460 CAACCAGCGGGCGCTGCCCCGGG - Intergenic
1148915127 17:50970231-50970253 GAGCCACCGCACCCGGCCCTTGG - Intronic
1150656771 17:67044616-67044638 CAGCCGCCGGACCCTGCCCAGGG + Exonic
1151557820 17:74855398-74855420 CAGCCAGTGGGTTCTGCCCTAGG + Intronic
1151620087 17:75240056-75240078 CAGGCAGCGGTCCCCGGCCTGGG + Exonic
1151818446 17:76483567-76483589 CAGCCACCACACCCGGCCCTAGG + Intronic
1152014530 17:77741787-77741809 CAGCCCTGAGACCCTGCCCTGGG + Intergenic
1152366918 17:79861705-79861727 CCCCCAGCTGACCCTGCTCTTGG + Intergenic
1152423180 17:80204966-80204988 CAGCCAGCCTACCCTGCCCCGGG - Intronic
1155271879 18:24149487-24149509 CACCCAGTGGATCCTGCACTGGG + Intronic
1157557042 18:48619670-48619692 CAGCCAGCAGCCCCTGCACCTGG - Exonic
1157667257 18:49498371-49498393 CATCCAGGGGAACCTGCCCTTGG + Intergenic
1157684167 18:49629430-49629452 CTGCCAGGGCACCCTGCACTTGG - Intergenic
1160015121 18:75134244-75134266 CAGCCAGAGGATGCTGCCCAGGG + Intergenic
1160858235 19:1226939-1226961 CATTCCGAGGACCCTGCCCTGGG + Intronic
1160913269 19:1484531-1484553 GAGCCACCGCACCCAGCCCTTGG - Intronic
1160938085 19:1606856-1606878 AAGCCACCGGGCCCGGCCCTGGG + Intergenic
1161101050 19:2422104-2422126 CACCCAGCAGACCCACCCCTGGG + Exonic
1161161668 19:2765145-2765167 CACCCGGCCGCCCCTGCCCTGGG + Intronic
1161709222 19:5838516-5838538 CAGCCTGCAGACCCTCCCCCAGG + Intronic
1162237630 19:9321492-9321514 CAGCCAGCCGTCCCTGCCCCGGG + Intergenic
1162462261 19:10820181-10820203 CTGTCAGCAGTCCCTGCCCTTGG + Intronic
1163572355 19:18089981-18090003 CCCCCAGCTGACCCTGGCCTGGG - Intronic
1166888407 19:45974881-45974903 CAGCCTGCAGCACCTGCCCTGGG + Intergenic
1167880245 19:52451516-52451538 CAGCCAGCGGGCCCAGCCCGCGG + Intronic
1168682635 19:58327082-58327104 CAGCCGGCGGACCCTTCCGGAGG - Exonic
925868261 2:8247548-8247570 CCCCCAGCCCACCCTGCCCTGGG + Intergenic
928106430 2:28473056-28473078 CACCCAGTGGATCCTGCACTGGG - Intronic
929815054 2:45223794-45223816 CAGCCAGCTGCCCCTAGCCTTGG - Intergenic
930022787 2:47011607-47011629 GAGTCAGGGGACCCTGCCATTGG - Intronic
932396527 2:71452711-71452733 CGGCCAGCCCATCCTGCCCTGGG + Intergenic
932418262 2:71586601-71586623 CAGGCAGGAGGCCCTGCCCTTGG + Intronic
932983484 2:76698385-76698407 CAGCCAGCGGAGCCGGCCCCGGG - Intergenic
933555230 2:83823397-83823419 GAGCCAGCCAACCCTGCCCCTGG - Intergenic
935657950 2:105441021-105441043 CAGCCTGCAGGCTCTGCCCTGGG - Intergenic
937207854 2:120248090-120248112 CAGCAAGAGGAGCTTGCCCTCGG - Intronic
938370162 2:130763586-130763608 CAGCCAGCTGACGATGCCCATGG - Exonic
939509548 2:143089533-143089555 CACCCAGTGGATCCTGCACTGGG + Intergenic
940707919 2:157126899-157126921 CAGGCAGGGAACCCTGGCCTGGG + Intergenic
940789460 2:158016621-158016643 CAGCCACTGCACCCAGCCCTGGG + Intronic
942358684 2:175148486-175148508 CAACCAACAGACCCTTCCCTTGG + Intronic
942450455 2:176105570-176105592 CAGCCAGCGCCGCCTGCCCTGGG + Intronic
943106085 2:183546614-183546636 CACCCAGTGGATCCTGCACTGGG + Intergenic
946185566 2:217978747-217978769 CAGCCCGCGGCCCCTTACCTTGG + Intronic
946336500 2:219040798-219040820 CACCCAGCGTCCCTTGCCCTGGG - Intronic
947577418 2:231287003-231287025 CAGCCATGGGCCTCTGCCCTGGG + Intronic
947727856 2:232410877-232410899 CAGCCTGCTGACACTGCCCCAGG - Intergenic
947931021 2:233965159-233965181 CTGCCAGAGGACCCAGCCCCTGG + Intronic
948019643 2:234719984-234720006 CAGACACAGGACCCTGCCCTAGG - Intergenic
948334021 2:237193839-237193861 CAGTCTCAGGACCCTGCCCTGGG + Intergenic
948453780 2:238094663-238094685 CAGCCACCCGAGCCTGCTCTTGG - Intronic
1168761499 20:353150-353172 CAGCCAGGGGCCCCTGGCCAAGG - Intronic
1170530684 20:17288037-17288059 CAGCCTGCAGAGCCAGCCCTTGG - Intronic
1171989352 20:31684071-31684093 CAGCTGGCTGACTCTGCCCTGGG - Intronic
1173046828 20:39520896-39520918 CACCATGCGGACCCTGCTCTTGG - Intergenic
1173224510 20:41154394-41154416 GAGCCAGCCAATCCTGCCCTAGG - Intronic
1173884068 20:46441348-46441370 AAGCCACCGCACCCTGCCTTTGG - Intergenic
1174222978 20:48972159-48972181 CAGCAACGGGACCCTGGCCTTGG - Intronic
1174358354 20:50012975-50012997 CAGCCAGGTGGACCTGCCCTGGG + Intergenic
1175180785 20:57145611-57145633 CAGAAAGCTGATCCTGCCCTGGG - Intergenic
1175254227 20:57629213-57629235 CACCCAGTGGATCCTGCCCCGGG - Intergenic
1176137510 20:63530628-63530650 CAGGATGCGGCCCCTGCCCTCGG - Intronic
1176179991 20:63745299-63745321 CAGCCAGGGCACCCTGTCATTGG + Exonic
1179255689 21:39713352-39713374 CAGCCAGCCCACCATGACCTGGG - Intergenic
1179435316 21:41358602-41358624 CAGCCTGCAAGCCCTGCCCTGGG + Intergenic
1179488760 21:41727243-41727265 CAGCCTGCTGTCCCTGCACTGGG + Intergenic
1180836992 22:18934857-18934879 CAGCCACAGGTCCCTGCCCAGGG - Intronic
1181027276 22:20133274-20133296 CAGCCTGGGGAGCCTGGCCTGGG + Intronic
1181166088 22:20983793-20983815 AAGCCAGGGGACCATGCCCAAGG - Intronic
1181438202 22:22922480-22922502 CGGCCTGAGGTCCCTGCCCTGGG + Intergenic
1181474624 22:23160675-23160697 AGGCCAGTGGACCCTGCCCCTGG + Intronic
1181493592 22:23275600-23275622 CAACAACCGGGCCCTGCCCTTGG + Intronic
1181580070 22:23823239-23823261 CAGCAAGCCCTCCCTGCCCTGGG - Intronic
1181745457 22:24952708-24952730 CAGCCCGCGGCACCTGCCCTGGG - Intronic
1182115764 22:27755402-27755424 GAACCAGAGGCCCCTGCCCTCGG - Intronic
1182245013 22:28950262-28950284 CACCCACCGCCCCCTGCCCTGGG + Intronic
1182747655 22:32617815-32617837 CAGGGAGAGGACCCTGCCCGAGG + Intronic
1183260804 22:36794622-36794644 CAGCCAGCTAAGCCTGCTCTCGG - Intergenic
1183528919 22:38341790-38341812 GAGCCACCGCACCCAGCCCTCGG + Intronic
1184482820 22:44758080-44758102 CAGCCAGAGGAAACTGCCATGGG - Intronic
1184501695 22:44878622-44878644 CAGCCAGCCCACCCTGAGCTGGG + Intergenic
1203287085 22_KI270734v1_random:160156-160178 CAGCCACAGGTCCCTGCCCAGGG - Intergenic
949343959 3:3059361-3059383 CAGCCAGTGGACCCTACCTGAGG - Intergenic
949875333 3:8623005-8623027 CAGCCAGGGGACCCTAACGTGGG - Intronic
950193159 3:10992087-10992109 CGGGCAGCAGACGCTGCCCTAGG + Intergenic
951037631 3:17951387-17951409 CAGCAAGGGGACCCTGGCCATGG - Intronic
953454660 3:43032122-43032144 CAGCCAGCTGTCCCTCCACTTGG + Intronic
953673993 3:44986052-44986074 CAACCAGTGGATCCTGCACTGGG + Intronic
959616588 3:108355522-108355544 CAGCCAGAAGAACCAGCCCTAGG - Intronic
960576287 3:119233090-119233112 GAGCCACCGCACCCAGCCCTGGG + Intronic
961126471 3:124423015-124423037 CAGCCAGCTGAGCCTGACCTGGG + Intronic
962007371 3:131361929-131361951 CAGCCTGCGGGCCCTGGCCATGG - Intergenic
962740601 3:138360482-138360504 CAGTCAGGGGGCCATGCCCTGGG + Intronic
962919201 3:139935685-139935707 CAGCCCCCGGACCCCGCCCAGGG - Intronic
964663118 3:159142700-159142722 CAGCCACCGTACCCAGCCCGGGG + Intronic
964751937 3:160060953-160060975 CACCCAGTGGACCCTGCACAGGG - Intergenic
966872303 3:184299068-184299090 CCGCCCTCGGACCCCGCCCTCGG - Exonic
968225108 3:196968491-196968513 GAGCCAGCGGACCCCGGCCTAGG + Intronic
968272935 3:197418701-197418723 CAGCCAGGGAGCCCAGCCCTTGG + Intergenic
968272952 3:197418764-197418786 CAGCCAGGGAGCCCAGCCCTTGG + Intergenic
968469747 4:773953-773975 CACCCAGTGGATCCTGCGCTGGG - Intergenic
968524503 4:1049168-1049190 CAGCCAGCAGCTCCTGCCCAGGG + Intergenic
968628998 4:1640752-1640774 CTGCCACCGGCACCTGCCCTGGG - Exonic
968629062 4:1640999-1641021 CTGCCACCGGCACCTGCCCTGGG - Exonic
969656074 4:8499276-8499298 CAGCCTGGGCCCCCTGCCCTGGG + Intergenic
969677487 4:8622061-8622083 CAGCCAGGGGATCCTGCCAGAGG - Intergenic
969678442 4:8627702-8627724 CAGCCAGGGGATCCTGCCAGAGG - Intergenic
969679398 4:8633336-8633358 CAGCCAGGGGATCCTGCCAGAGG - Intergenic
970051316 4:11918059-11918081 CACCCAGTGGATCCTGCACTGGG - Intergenic
970182666 4:13415808-13415830 CACCCAGTGGATCCTGCACTGGG - Intronic
970663105 4:18308115-18308137 CAGCCAGCAGAGCATGTCCTGGG + Intergenic
970692010 4:18630832-18630854 CAGCCAGCGCCACCGGCCCTGGG - Intergenic
971143073 4:23946020-23946042 GAGACAGCGGATTCTGCCCTGGG - Intergenic
972120169 4:35692320-35692342 GAGCCACCGCACCCCGCCCTAGG - Intergenic
972301201 4:37787304-37787326 CAGCAGGCGGACCCTGCACCTGG - Intergenic
972766173 4:42153456-42153478 CAACCAGCATACCCTGCCCCAGG + Intergenic
972966639 4:44518570-44518592 CAGCCATCGCACCCGGCCCAGGG + Intergenic
973048656 4:45567478-45567500 CACCCAGTGGATCCTGCACTTGG - Intergenic
973310980 4:48709202-48709224 GAGCCACCGCACCCAGCCCTAGG + Intronic
975523802 4:75327948-75327970 CACCCAGCTGACTGTGCCCTAGG + Intergenic
975745016 4:77466768-77466790 CACCCAGTGGATCCTGCCCGGGG - Intergenic
978466243 4:109012576-109012598 CAGCCGGCGGTGCCAGCCCTGGG + Intronic
978917902 4:114148515-114148537 CACCCAGTGGATCCTGCACTGGG + Intergenic
981146747 4:141333308-141333330 CAGCCGGCCGGCCCTGCACTCGG - Intergenic
981146754 4:141333333-141333355 CAGCCGGCCGGCCCTGCACTCGG - Intergenic
981146761 4:141333358-141333380 CAGCCGGCCGGCCCTGCACTCGG - Intergenic
981146768 4:141333383-141333405 CAGCCGGCCGGCCCTGCACTCGG - Intergenic
981146775 4:141333408-141333430 CAGCCGGCCGGCCCTGCACTCGG - Intergenic
981146782 4:141333433-141333455 CAGCCGGCCGGCCCTGCACTCGG - Intergenic
981146789 4:141333458-141333480 CAGCCGGCCGGCCCTGCACTCGG - Intergenic
981750817 4:148091120-148091142 CATCTGGCGCACCCTGCCCTGGG + Intronic
982389322 4:154847678-154847700 CAGCAAGGGGACCCTGGGCTGGG - Intergenic
982690346 4:158541058-158541080 CAGCCAACAGTCACTGCCCTGGG + Intronic
988883673 5:35532053-35532075 CACCCAGTGGATCCTGCACTGGG - Intergenic
991176630 5:63695871-63695893 CAGCCACTGCACCCTGCCTTGGG - Intergenic
993927042 5:93878511-93878533 CAGTCTGAGGACCCTGCCCCAGG - Intronic
994230041 5:97301574-97301596 CACCCAGTGGATCCTGCACTGGG - Intergenic
994932366 5:106206024-106206046 CACCCAGTGGATCCTGCACTGGG + Intergenic
995566754 5:113438960-113438982 CAGCCAGGGGATCCTGCCCAAGG - Intronic
995756354 5:115508782-115508804 GAGCCACCGTACCCGGCCCTTGG - Intergenic
997505287 5:134412037-134412059 CAGCCCGTGGCTCCTGCCCTGGG + Intergenic
998722599 5:144971659-144971681 CAGCCCGTGAACCCTGACCTCGG - Intergenic
1000302912 5:159972177-159972199 CAGCCAGCGGACCCTGCCCTCGG + Exonic
1002078555 5:176724072-176724094 CAGACAGCTGCCCTTGCCCTTGG - Intergenic
1002207014 5:177569840-177569862 CAGCCAGAGGACTCGCCCCTGGG - Intergenic
1002425924 5:179175868-179175890 CAGCCTGCTGAACCTGCTCTGGG - Intronic
1002459350 5:179365289-179365311 CAGCCAGCCCACCCTGCTCCAGG + Intergenic
1003859202 6:10306766-10306788 GAGCCACCGCACCCGGCCCTGGG - Intergenic
1003882000 6:10487722-10487744 CACCCAGTGGATCCTGCACTAGG + Intergenic
1004667778 6:17764371-17764393 CAGCCAGGGGATTCTGCCCCAGG - Exonic
1004912699 6:20301678-20301700 CACCCAGTGGATCCTGCACTGGG - Intergenic
1005368802 6:25108113-25108135 CAACCAGAGGACCCTCCTCTGGG + Intergenic
1005600788 6:27424762-27424784 CACCCAGTGGACCCCGCGCTGGG + Intergenic
1006367202 6:33622538-33622560 AAGATAGCCGACCCTGCCCTGGG - Intronic
1006670931 6:35729165-35729187 CAGCCTGAGGTCCCTCCCCTAGG - Intergenic
1006748820 6:36364166-36364188 CACCCAGTGGATCCTGCACTGGG + Intronic
1006837648 6:37008715-37008737 CACCCAGGGGCCCCTGCACTGGG + Intronic
1007327459 6:41073220-41073242 CGGCCAGCGGCCCCGGCCCGGGG + Intronic
1014904388 6:127008613-127008635 CAGCCAACAGAGCCTGCACTGGG - Intergenic
1019061748 6:169262417-169262439 CAGCCAGAGGTCCATGCCCTGGG + Intergenic
1019580726 7:1760727-1760749 GAGCCACCGCACCCGGCCCTCGG - Intergenic
1019595847 7:1857947-1857969 CAGCCAAGGGACTCGGCCCTGGG - Intronic
1019599100 7:1872601-1872623 CAGAGAGCGGCCTCTGCCCTGGG - Intronic
1019618830 7:1979627-1979649 CGGCCTGCAGACCCTGCTCTAGG + Intronic
1020105465 7:5420503-5420525 CAGCCTTGGGACCCTGGCCTCGG - Intronic
1020267858 7:6573357-6573379 GAGCCACCGCACCCGGCCCTGGG + Intergenic
1021274731 7:18636285-18636307 CTGCCAGCCCCCCCTGCCCTGGG + Intronic
1022534268 7:31086047-31086069 CAGCCAGAGGACCCTGCAGGAGG - Intronic
1022750517 7:33219399-33219421 CACCCAGTGGACCCTGCACTGGG - Intronic
1023867075 7:44243395-44243417 CAGCCAACACACCCTGCCCCTGG + Intronic
1023874219 7:44278086-44278108 CAGCCAGGGGCGCCTGCCATGGG + Intronic
1024670837 7:51592981-51593003 CAGCAAGCTCACACTGCCCTGGG + Intergenic
1024765785 7:52657567-52657589 CAGCCAGCCATCCCTGCCCATGG + Intergenic
1026953782 7:74364320-74364342 CAGTCAGAGGCCCCTTCCCTGGG + Intronic
1026970353 7:74464006-74464028 GAGCCACCGCGCCCTGCCCTAGG + Intronic
1027579636 7:79977538-79977560 CACCCAGTGGATCCTGCACTGGG + Intergenic
1029196514 7:98809375-98809397 CAGCCAGGTGACCCTGCCAAGGG + Intergenic
1029634739 7:101776410-101776432 GAGCCAGGGCACTCTGCCCTTGG - Intergenic
1030292727 7:107888244-107888266 CACCCAGTGGATCCTGCGCTGGG - Intergenic
1031309090 7:120171843-120171865 CAGCCATAGCACCCTGCTCTGGG - Intergenic
1034128893 7:148698514-148698536 GAGCCTGCGGCCCCTGCCCCCGG - Intronic
1034651849 7:152697547-152697569 CACCCAGTGGATCCTGCACTGGG - Intergenic
1034840224 7:154388628-154388650 CAGCCAGAGCACGCTGGCCTGGG - Intronic
1034980512 7:155473057-155473079 CTGCCAGCTGCCCCTCCCCTCGG - Intergenic
1035047018 7:155974294-155974316 CAGCCTGCAGACCCAGCCCTGGG - Intergenic
1035254346 7:157616578-157616600 GTGCCAGCCGACTCTGCCCTAGG - Exonic
1035683496 8:1507103-1507125 CACCTAGCGGATCCTGCGCTGGG + Intronic
1037768219 8:21784607-21784629 CAGCCAGGAGACCCATCCCTAGG + Intronic
1038725957 8:30082861-30082883 CTGACCGCGGGCCCTGCCCTGGG - Exonic
1038912008 8:31975301-31975323 CAGCCAGCGGTCTCAGCCTTGGG - Intronic
1039509369 8:38078592-38078614 AAGCCACCGCACCCTGGCCTGGG + Intergenic
1040351349 8:46571951-46571973 CACCCAGTGGATCCTGCACTGGG - Intergenic
1041477109 8:58278827-58278849 CAGCCAGAAGTCCTTGCCCTGGG - Intergenic
1047074242 8:121382039-121382061 GAGCCACCGCACCCAGCCCTGGG - Intergenic
1047521337 8:125597436-125597458 CAACCAGCAGCCCCTGCCATAGG - Intergenic
1047631625 8:126714572-126714594 CACCCAGTGGACCCCGCACTGGG + Intergenic
1047954268 8:129961341-129961363 CACCCAGCAGAGCCAGCCCTGGG + Intronic
1048219597 8:132529210-132529232 CAGTCACCTGACCCTGTCCTAGG + Intergenic
1048872677 8:138812300-138812322 CAGCCAGCGCACCCGGCTCAGGG - Intronic
1049277245 8:141726032-141726054 CAGCCAGGGGACAATGCACTTGG - Intergenic
1049319710 8:141989581-141989603 CAGCCAGCAGCCCCTTCCTTGGG + Intergenic
1049384160 8:142332675-142332697 CAGCCTGCAGACCCTTCCCATGG - Intronic
1049648130 8:143746031-143746053 GAGCCACCGTACCTTGCCCTTGG + Intergenic
1053353650 9:37429532-37429554 CAGCCAGCCCACACTGCCCCAGG - Intronic
1054762335 9:69014165-69014187 CAGCCAGCGCAGCCAGCCCCAGG - Intergenic
1055838585 9:80475191-80475213 CAGCCAAGGAAACCTGCCCTAGG + Intergenic
1057248646 9:93481178-93481200 CAGCCAGGGGGCCCTGCCCAGGG - Intronic
1057300777 9:93880334-93880356 CACCCAGTGGATCCTGCACTGGG - Intergenic
1059215332 9:112556295-112556317 CAGGCAGCAGACTTTGCCCTGGG - Intronic
1061119373 9:128633860-128633882 CAGCCAGCAGACTCAGCTCTTGG - Exonic
1061351516 9:130069022-130069044 GAGCCAGCGTGCCCTGCCCTAGG + Intronic
1062119863 9:134828343-134828365 CAGCCAGCTCACGCTGCCATGGG - Intronic
1062140717 9:134957321-134957343 CAGCCACCGAGCCCAGCCCTCGG + Intergenic
1062178154 9:135175784-135175806 CAGCCAGCTGACCCTGGCTCTGG - Intergenic
1062407760 9:136404994-136405016 CAGCCGGTGCAGCCTGCCCTTGG - Intronic
1062456169 9:136640221-136640243 TAGCCACCGCACCCAGCCCTGGG + Intergenic
1062617246 9:137403435-137403457 CAGCCAGCACACCCTGGCCCAGG + Intronic
1062732113 9:138115828-138115850 CTGCCATCCGACCCTGCACTTGG + Intronic
1188114173 X:26223373-26223395 CAGCCTGCCAACCCTGCCTTAGG - Intergenic
1188397601 X:29704382-29704404 GAGCCACCGCACCCTGCCATAGG - Intronic
1188492106 X:30748729-30748751 CAGCTAGAGGACTCTGCGCTGGG - Intergenic
1190271014 X:48863636-48863658 GAGCCACCGCACCCTGCCCCTGG - Intergenic
1190517804 X:51243161-51243183 CTGCCAGGGTACACTGCCCTGGG - Intergenic
1193012189 X:76688413-76688435 CAGGCAGCAGACCATGCCATGGG - Intergenic
1194025527 X:88746310-88746332 CACCCAGTGGATCCTGCACTAGG + Intergenic
1197000212 X:121431464-121431486 CACCCAGTGGATCCTGCCCCAGG + Intergenic
1199951097 X:152706734-152706756 ACGCCAGCGGTCACTGCCCTAGG - Intergenic
1199958587 X:152761727-152761749 ACGCCAGCGGTCACTGCCCTAGG + Intergenic
1200989754 Y:9336716-9336738 GAGCCAGAGGCCCCGGCCCTGGG + Intergenic
1200992422 Y:9357049-9357071 GAGCCAGAGGCCCCGGCCCTGGG + Intergenic
1200995074 Y:9377327-9377349 GAGCCAGAGGCCCCGGCCCTGGG + Intronic
1200997739 Y:9397673-9397695 GAGCCAGAGGCCCCGGCCCTGGG + Intergenic
1201000249 Y:9466207-9466229 GAGCCAGAGGCCCCGGCCCTGGG + Intergenic
1201002910 Y:9486519-9486541 GAGCCAGAGGCCCCGGCCCTGGG + Intronic
1201005568 Y:9506802-9506824 GAGCCAGAGGCCCCGGCCCTGGG + Intergenic
1201008229 Y:9527132-9527154 GAGCCAGAGGCCCCGGCCCTGGG + Intergenic