ID: 1000304554

View in Genome Browser
Species Human (GRCh38)
Location 5:159983568-159983590
Sequence CCGTCTTAGCCGTGGGAATG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000304550_1000304554 20 Left 1000304550 5:159983525-159983547 CCAGACACGCTTAAGATACAGTG No data
Right 1000304554 5:159983568-159983590 CCGTCTTAGCCGTGGGAATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000304554 Original CRISPR CCGTCTTAGCCGTGGGAATG TGG Intergenic
No off target data available for this crispr