ID: 1000307632

View in Genome Browser
Species Human (GRCh38)
Location 5:160009798-160009820
Sequence CCCTTCCAGTGTAAGCTGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 140}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000307621_1000307632 18 Left 1000307621 5:160009757-160009779 CCCCACGGTAATCCTGATTAGGG 0: 1
1: 0
2: 0
3: 3
4: 38
Right 1000307632 5:160009798-160009820 CCCTTCCAGTGTAAGCTGAGTGG 0: 1
1: 0
2: 0
3: 6
4: 140
1000307628_1000307632 -8 Left 1000307628 5:160009783-160009805 CCTGCGCCAGGGTTCCCCTTCCA 0: 1
1: 0
2: 0
3: 24
4: 182
Right 1000307632 5:160009798-160009820 CCCTTCCAGTGTAAGCTGAGTGG 0: 1
1: 0
2: 0
3: 6
4: 140
1000307623_1000307632 17 Left 1000307623 5:160009758-160009780 CCCACGGTAATCCTGATTAGGGT 0: 1
1: 0
2: 0
3: 1
4: 19
Right 1000307632 5:160009798-160009820 CCCTTCCAGTGTAAGCTGAGTGG 0: 1
1: 0
2: 0
3: 6
4: 140
1000307618_1000307632 30 Left 1000307618 5:160009745-160009767 CCTGACTCTGGCCCCCACGGTAA 0: 1
1: 0
2: 0
3: 2
4: 77
Right 1000307632 5:160009798-160009820 CCCTTCCAGTGTAAGCTGAGTGG 0: 1
1: 0
2: 0
3: 6
4: 140
1000307625_1000307632 6 Left 1000307625 5:160009769-160009791 CCTGATTAGGGTCACCTGCGCCA 0: 1
1: 0
2: 0
3: 2
4: 42
Right 1000307632 5:160009798-160009820 CCCTTCCAGTGTAAGCTGAGTGG 0: 1
1: 0
2: 0
3: 6
4: 140
1000307619_1000307632 19 Left 1000307619 5:160009756-160009778 CCCCCACGGTAATCCTGATTAGG 0: 1
1: 0
2: 0
3: 4
4: 52
Right 1000307632 5:160009798-160009820 CCCTTCCAGTGTAAGCTGAGTGG 0: 1
1: 0
2: 0
3: 6
4: 140
1000307624_1000307632 16 Left 1000307624 5:160009759-160009781 CCACGGTAATCCTGATTAGGGTC 0: 1
1: 0
2: 0
3: 0
4: 32
Right 1000307632 5:160009798-160009820 CCCTTCCAGTGTAAGCTGAGTGG 0: 1
1: 0
2: 0
3: 6
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000307632 Original CRISPR CCCTTCCAGTGTAAGCTGAG TGG Intronic
901489715 1:9590376-9590398 CCCATCCTGGGTTAGCTGAGAGG - Intronic
902491306 1:16783100-16783122 CCCTTCAGGTGGAAGGTGAGTGG - Intronic
902544166 1:17176423-17176445 CCTTTCCAGGGAAGGCTGAGTGG + Intergenic
903773440 1:25778317-25778339 CCCTTGCAGGGTTACCTGAGCGG - Exonic
906685295 1:47759386-47759408 ACCGTCCAGTGTCAGCTGACTGG - Intergenic
909308395 1:74112482-74112504 CCCTTCCAGGGTAATCTTTGAGG - Intronic
909686591 1:78355500-78355522 TTCTTCCAGTGTAAACTAAGAGG - Intronic
913661354 1:121008769-121008791 CGCGTCCACTGTAAGCTCAGGGG - Intergenic
913996032 1:143652466-143652488 CCTGTCCACTGTAAGCTCAGAGG - Intergenic
914012721 1:143791949-143791971 CGCGTCCACTGTAAGCTCAGGGG - Intergenic
914165109 1:145169235-145169257 CGCGTCCACTGTAAGCTCAGGGG + Intergenic
914193642 1:145431943-145431965 CTCGTCCACTGTAAGCTCAGGGG - Intergenic
914376789 1:147079471-147079493 CGCGTCCACTGTAAGCTCAGGGG + Intergenic
914474970 1:148014833-148014855 CTCGTCCACTGTAAGCTCAGGGG - Intergenic
914651346 1:149700558-149700580 CGCGTCCACTGTAAGCTCAGGGG - Intergenic
915117434 1:153609484-153609506 CCCAGCCAGTGCTAGCTGAGTGG - Intronic
918792901 1:188853575-188853597 TCCTTGCTGTGTTAGCTGAGTGG - Intergenic
921026648 1:211289910-211289932 CTCTTCCTGTGTAACCTTAGAGG + Intronic
921782596 1:219184517-219184539 TCCTTCCTGTGTAATCTTAGAGG + Intronic
923529136 1:234799438-234799460 CCCTTCAGGTGGAAGGTGAGTGG + Intergenic
1069711880 10:70494747-70494769 CCCTTCCACAGGAAGCTGTGAGG - Intronic
1070895985 10:79983174-79983196 CCCAGCCAGTTGAAGCTGAGGGG - Intergenic
1073529174 10:104215859-104215881 ACCTTCCATTGTAAGGGGAGAGG - Intronic
1075046918 10:119153668-119153690 CCCTCCCAGTGTGTGCTGATTGG - Intronic
1075541356 10:123317016-123317038 AGCTTCCAGAGCAAGCTGAGAGG + Intergenic
1075551262 10:123394424-123394446 TCCTTCAAGTCTCAGCTGAGTGG + Intergenic
1076635726 10:131880778-131880800 CGCTTCCAGGGAAAGCTGATTGG - Intergenic
1078717054 11:13850327-13850349 CCCTTCAAGTGTCTGCAGAGAGG + Intergenic
1078830022 11:14969875-14969897 ACCTTCCTGTGTATGCTGCGGGG + Intronic
1078840986 11:15075236-15075258 ACCTTCCTGTGTATGCTGCGGGG - Intronic
1079605675 11:22362954-22362976 TCCTTCCATTGTATTCTGAGAGG + Intronic
1082102342 11:48183129-48183151 CCCTTCCAGAGCAACCTGTGTGG + Intergenic
1084282704 11:68108998-68109020 TCCTTACAGTGAAAACTGAGGGG + Intronic
1084296519 11:68216002-68216024 CTCTTCCAGCCTCAGCTGAGAGG + Intergenic
1084954719 11:72685148-72685170 TCCTTCCAGTCTGGGCTGAGTGG - Exonic
1088393770 11:109344884-109344906 CCCTTCCAGTTAAAGCTGGAAGG + Intergenic
1091692292 12:2605438-2605460 TCCTTCCACTGTAAGATGGGAGG + Intronic
1094634683 12:32214346-32214368 TCCTAGCACTGTAAGCTGAGAGG - Intronic
1096231018 12:49896984-49897006 CCCTTCCAGAGAAGGCTTAGTGG - Intronic
1102320783 12:111932233-111932255 CCCATCCAGAGTAAACTGAATGG - Intronic
1102474507 12:113179927-113179949 CCCATCCAGAGGAAGGTGAGGGG - Exonic
1108097940 13:46924178-46924200 CCCATCTAGTGAAGGCTGAGTGG - Intergenic
1109747476 13:66645953-66645975 GCCTCCCAGTGTAAGCCAAGTGG - Intronic
1110719001 13:78740231-78740253 CCCTTCAACTCTTAGCTGAGTGG - Intergenic
1113406154 13:110042555-110042577 CTTTTCCAGTTTGAGCTGAGTGG - Intergenic
1115960895 14:38835725-38835747 CCCTTCAAGTGTTAGCAGTGAGG + Intergenic
1118007972 14:61582317-61582339 GACTTCAAGTGTAAGCTGAGAGG + Intronic
1119465293 14:74852943-74852965 CACATGGAGTGTAAGCTGAGTGG - Exonic
1121472308 14:94165235-94165257 CCCTTCCAGAGACAGCTGAGGGG + Intronic
1124165835 15:27324855-27324877 CCCTTCCACTGAAAGCTGTAGGG - Intronic
1128315600 15:66657415-66657437 CCCTTGGGGAGTAAGCTGAGGGG - Intronic
1130912342 15:88279472-88279494 TGCTTCAAGTGTAATCTGAGTGG - Intergenic
1135521091 16:23178960-23178982 CCCTCACAGTGTTAGCTGATTGG + Intergenic
1136590321 16:31214587-31214609 CCCATCCAGTGTAGGATGTGAGG + Intronic
1139681093 16:68563880-68563902 CCCTTCCAGTGTAAGGAATGTGG + Exonic
1140047156 16:71448328-71448350 CCCTTTCAGTGTAAGGAGTGTGG - Exonic
1140047251 16:71449252-71449274 CCCTATCAGTGTAAGATGTGTGG - Exonic
1142068254 16:88074832-88074854 GCCTTCCAGGGTAGGATGAGGGG - Intronic
1143367230 17:6416085-6416107 CTCCTCCAGGGTAAGGTGAGGGG - Intronic
1147345632 17:39791553-39791575 CCATTCCAGTGTAATCAGTGTGG - Exonic
1147959561 17:44158299-44158321 CCCATCCTGAGTAAGCTTAGAGG + Intronic
1148462369 17:47846111-47846133 CCCTTCCCCTGTGAGATGAGGGG + Exonic
1152069299 17:78127095-78127117 CCCCTCCAGTGTCAGGGGAGGGG + Intronic
1153982193 18:10320100-10320122 CCCTTCCAAGGTTAGCAGAGAGG + Intergenic
1157137804 18:45074245-45074267 TCCTTGCTGTGTCAGCTGAGAGG - Intergenic
1157277545 18:46322459-46322481 ACCTTCCAGTGGAATTTGAGTGG - Intergenic
1159788903 18:72751576-72751598 CCCTCCAAGTGAAGGCTGAGAGG - Intronic
1160267623 18:77353863-77353885 CCATTCCTGTGTAATCTGAAGGG + Intergenic
1161011372 19:1960927-1960949 CTCTTCCTGTGGATGCTGAGAGG + Intronic
1163801410 19:19367965-19367987 CCCTCCCAGTGTCCCCTGAGGGG - Intergenic
1165822554 19:38685764-38685786 CTATTCCAGTGAAAGCAGAGAGG - Intronic
925109259 2:1319634-1319656 TTCTTCCTGTGTAAGCTGTGAGG - Intronic
925761339 2:7187655-7187677 CTTTTCCAATGGAAGCTGAGAGG - Intergenic
925786531 2:7436557-7436579 CCTTTCCACTGTAAAATGAGAGG - Intergenic
929453147 2:42049392-42049414 CCCTTCCAGTGTCTTCTGGGTGG - Intronic
932840473 2:75077461-75077483 CTCTTCCAGAAGAAGCTGAGAGG + Intronic
934631940 2:95935512-95935534 CTCTTTCAGAGTAAGCTGAATGG + Exonic
934801560 2:97167687-97167709 CTCTTTCAGAGTAAGCTGAATGG - Exonic
936611306 2:114004736-114004758 CCTTTGCTGTGGAAGCTGAGGGG + Intergenic
937769090 2:125697484-125697506 CCCTAACAGTGTGAGCTGCGTGG + Intergenic
940004668 2:148999644-148999666 CCCTTCCAGTCGAATCTGTGAGG - Intronic
945464263 2:210148504-210148526 TCCTTCCACTGTAAGATGAATGG - Intronic
945692113 2:213049850-213049872 CCCTTCCACTGTAACCAGTGTGG - Exonic
946672771 2:222123978-222124000 CCATTCCAGTGTAAAATGTGTGG - Intergenic
947493038 2:230612142-230612164 TCCTTCCAGTGCAGGCTCAGAGG + Intergenic
947749978 2:232526836-232526858 CCCCTCCAGTGTCAGCTCTGCGG + Intronic
948340991 2:237251684-237251706 TCCTTGCTGTGTCAGCTGAGAGG + Intergenic
1171368316 20:24642435-24642457 CCCTTCGAGTGTGGGCTGTGCGG - Intronic
1172362531 20:34323818-34323840 CCTTTCCAGTGACAGCTGCGTGG + Intergenic
1173772029 20:45668198-45668220 CCCTTACAGTGCTAGCAGAGGGG + Intronic
1174609931 20:51790684-51790706 CCGTTCCAGTGTAAGATCTGTGG - Exonic
1176909285 21:14543223-14543245 CACTTACAGTATAGGCTGAGAGG - Intronic
1177791038 21:25722144-25722166 CCATTCCAGTGGGAGCTAAGGGG + Intronic
1177978058 21:27876003-27876025 CTCTTCCAGTCTCTGCTGAGTGG + Intergenic
1180061612 21:45388214-45388236 TCCCTCCAGTGGAGGCTGAGAGG - Intergenic
1183137224 22:35900642-35900664 CCCTGCTATTTTAAGCTGAGAGG - Intronic
1184784749 22:46666210-46666232 CCCTCCCTGTGGAGGCTGAGGGG + Intronic
952263799 3:31766196-31766218 CATCTCCAGTGTCAGCTGAGTGG - Intronic
952729883 3:36627556-36627578 CCCCTCCAGTCTCAGCTGGGAGG - Intergenic
953780203 3:45862305-45862327 CCCCTCCAGTGGAGGCTGAAGGG - Intronic
962009302 3:131378725-131378747 TCCTTCCTCTGTCAGCTGAGTGG - Intergenic
963046901 3:141109366-141109388 CCTTTCCACTGTAAGATGAGGGG - Intronic
965619916 3:170633148-170633170 TCCTTTCAATGTAAGCAGAGTGG - Intronic
966439426 3:179927362-179927384 TCCTGCCAGTGTAAGGAGAGAGG + Intronic
971371640 4:26024067-26024089 CACTTCCAGGGTAGGCTGAGGGG + Intergenic
973801537 4:54483301-54483323 CCCTTGCAGTGAGTGCTGAGAGG - Intergenic
973960648 4:56106546-56106568 CCCTTTCAGTGTTAGCTATGTGG + Intergenic
981454740 4:144940395-144940417 CTCTTTCAGTGTAATGTGAGTGG - Intergenic
983832537 4:172346074-172346096 CCATTCCAGTATAAGCCAAGAGG - Intronic
984609490 4:181821306-181821328 TCCTTCCAGTGGAATCTGGGAGG - Intergenic
993030491 5:82700169-82700191 CACTTCCAGAGTAAGTTGAATGG - Intergenic
995102203 5:108326017-108326039 CCCTTAAAGTGTAAACTCAGTGG - Intronic
1000307632 5:160009798-160009820 CCCTTCCAGTGTAAGCTGAGTGG + Intronic
1002275130 5:178099439-178099461 CTCCTCCAGCATAAGCTGAGGGG + Intergenic
1002882584 6:1265986-1266008 TCGTTCCAGTGTAAGGTCAGTGG - Intergenic
1003469868 6:6419393-6419415 CCCTTGCTCTGTCAGCTGAGAGG - Intergenic
1005016021 6:21376148-21376170 CCCTTCCATGCAAAGCTGAGAGG + Intergenic
1007235901 6:40391379-40391401 CCCTTCCAGTGTCGGGTGTGGGG + Intergenic
1007361136 6:41356733-41356755 CCATTCCAGGGTAGGCTAAGAGG + Intergenic
1007378760 6:41473265-41473287 TCCTGCTAGTGTCAGCTGAGGGG - Intergenic
1007821628 6:44564729-44564751 ACCTTCCAGTTCTAGCTGAGGGG + Intergenic
1010543483 6:77122083-77122105 CCCTTCCTTTGTTAGTTGAGAGG + Intergenic
1014399944 6:120975893-120975915 CCCTTCCAAGGTAAGATGGGAGG + Intergenic
1015650653 6:135455001-135455023 CCCTTCCAGTGTAAGCTAGATGG - Intronic
1018133781 6:160757907-160757929 TTCTTCCAGTGTAAGGTGACAGG - Intergenic
1022210525 7:28204630-28204652 CCCTTACAGTGTGAGTTTAGAGG - Intergenic
1024529461 7:50379340-50379362 CCCTTCCAGGATACACTGAGAGG + Intronic
1024529795 7:50382548-50382570 CCCTTCCAGTGCAATCAGTGCGG + Exonic
1032562931 7:132911374-132911396 TCCTTCCAGTGTGATCTGAAAGG - Intronic
1032646611 7:133831759-133831781 TCCTTTCAGTGTCAACTGAGTGG - Intronic
1038537243 8:28362132-28362154 GTCTTCAAGTGTAAGATGAGAGG - Intronic
1041463721 8:58138547-58138569 CCCAGCCAGTGTGAGATGAGAGG + Intronic
1041602172 8:59732003-59732025 CCCTTCCAGTCTCACCTGACAGG + Intergenic
1043611745 8:82072661-82072683 CACATCCAGTGTAACATGAGAGG + Intergenic
1046811513 8:118538389-118538411 CCCTGCCACTGTAAGCTAAAGGG - Intronic
1049316852 8:141973849-141973871 CCCTTCGTGTGAAAGCAGAGAGG - Intergenic
1049396801 8:142404711-142404733 CCCTTCAAGTGGAAGCTGGGGGG - Intergenic
1050140094 9:2508572-2508594 TCCTTGCTGTGTCAGCTGAGAGG - Intergenic
1051910118 9:22144558-22144580 TCCTTGCTCTGTAAGCTGAGAGG - Intergenic
1058702499 9:107612660-107612682 CCTTTCCAGAGCAAGCTGAAGGG + Intergenic
1060732887 9:126049294-126049316 CCCTGGCAGTCTCAGCTGAGGGG + Intergenic
1062059771 9:134488911-134488933 TCATTCCAGTGTGAGATGAGGGG + Intergenic
1187321329 X:18240145-18240167 CCCCTGAAGAGTAAGCTGAGAGG + Exonic
1187581703 X:20614333-20614355 CATTTCCTGTGTATGCTGAGGGG + Intergenic
1190217386 X:48489027-48489049 CCCTGTCAGTGTGAGCTGGGAGG + Intergenic
1194071780 X:89333409-89333431 CACTTCCAATATATGCTGAGAGG + Intergenic
1197865698 X:131014584-131014606 CCCTACCAGGGTTAGCTAAGTGG + Intergenic