ID: 1000308398

View in Genome Browser
Species Human (GRCh38)
Location 5:160017504-160017526
Sequence TGAAATAATCCCCATTGTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 325
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 301}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000308398_1000308401 -6 Left 1000308398 5:160017504-160017526 CCAACACAATGGGGATTATTTCA 0: 1
1: 0
2: 2
3: 21
4: 301
Right 1000308401 5:160017521-160017543 ATTTCAACATGAATTTTGGAGGG 0: 77
1: 561
2: 2178
3: 3329
4: 6234
1000308398_1000308400 -7 Left 1000308398 5:160017504-160017526 CCAACACAATGGGGATTATTTCA 0: 1
1: 0
2: 2
3: 21
4: 301
Right 1000308400 5:160017520-160017542 TATTTCAACATGAATTTTGGAGG 0: 3
1: 122
2: 897
3: 2761
4: 3835
1000308398_1000308399 -10 Left 1000308398 5:160017504-160017526 CCAACACAATGGGGATTATTTCA 0: 1
1: 0
2: 2
3: 21
4: 301
Right 1000308399 5:160017517-160017539 GATTATTTCAACATGAATTTTGG 0: 1
1: 3
2: 12
3: 89
4: 770

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000308398 Original CRISPR TGAAATAATCCCCATTGTGT TGG (reversed) Intronic
904293770 1:29504690-29504712 TGGAATGATCCCCATTTTGCAGG + Intergenic
907245303 1:53104631-53104653 TGAAATAAGCCAGATTGTGAAGG - Intronic
908103523 1:60815551-60815573 TGAAATATTTCCCATTATTTAGG + Intergenic
908257553 1:62315407-62315429 TGCCATAATCCCCAATGTGTAGG - Intronic
909022895 1:70452093-70452115 CGAAGTAATACACATTGTGTGGG - Intergenic
909052402 1:70782511-70782533 TGACCTAATCCCCAGTGTGATGG + Intergenic
909416824 1:75416083-75416105 TGACATTTTCCCCATTGTCTTGG - Intronic
909808861 1:79906011-79906033 AGATATATTCCCCATTGTCTTGG + Intergenic
914938239 1:151999564-151999586 AGGAATAAGCCCCATTGTGTGGG + Intergenic
916181599 1:162088710-162088732 GGAAATCATCACCATTGTTTGGG - Intronic
916368718 1:164063901-164063923 TGGAATAATCCCAATTTTGCTGG + Intergenic
916495576 1:165343935-165343957 TGAAATAATTCACATTGGGATGG - Intronic
919371977 1:196739231-196739253 AGATATATTCCCCATTGTCTTGG + Intronic
921667619 1:217891532-217891554 TGGAATAATTCCCATTGTGGTGG + Intergenic
921880457 1:220249608-220249630 TGACATTTTCCCCATTGTCTTGG - Intronic
922688282 1:227665043-227665065 TGGTATAATCCCCATTGGGTAGG - Intronic
923023560 1:230186452-230186474 TCAGATGCTCCCCATTGTGTGGG - Intronic
924448944 1:244160247-244160269 TGAAGGAATCCACACTGTGTAGG + Intergenic
1063197288 10:3755488-3755510 TGAATTAATCCTCCTTGTGATGG + Intergenic
1064461572 10:15539847-15539869 TGTAATAATCCCCAGTGTCAAGG + Intronic
1064912107 10:20414119-20414141 TGCAAAAATTCCCATTCTGTAGG - Intergenic
1066193985 10:33080975-33080997 TTAAATAATGGCCATTGTGATGG + Intergenic
1067292210 10:44951560-44951582 TCATAAAATCCCCATTGTTTGGG + Intergenic
1068928189 10:62561537-62561559 TAAAATTATACCCATTTTGTGGG + Intronic
1069239707 10:66123978-66124000 AGACATTATCCCCATTGTCTTGG + Intronic
1069367809 10:67712364-67712386 AGACATATTCCCCATTGTCTTGG - Intergenic
1072106968 10:92283684-92283706 AGAAATAGACCCCATTCTGTAGG - Intronic
1073314905 10:102572757-102572779 TTAAATGATCCCAATTTTGTTGG + Intronic
1073841591 10:107504259-107504281 AGACATATTCCCCATTGTCTTGG + Intergenic
1073864542 10:107787028-107787050 TGACATTTTCCCCATTGTCTTGG - Intergenic
1073883332 10:108008165-108008187 TGACATTTTCCCCATTGTCTTGG + Intergenic
1074310129 10:112315228-112315250 GGAAATAATCCCCCCTATGTGGG + Intergenic
1077261698 11:1625356-1625378 GGAATGAATCCCAATTGTGTAGG - Intergenic
1079546779 11:21642915-21642937 AGAAATTTTCCCCATTGTCTTGG - Intergenic
1080180939 11:29425474-29425496 TGAAATCATCCCCAGTGTCATGG + Intergenic
1080329972 11:31125240-31125262 TGTAATAATCACCATTCTGACGG - Intronic
1080516862 11:33030965-33030987 TGAAGTAAGCAACATTGTGTTGG + Intronic
1081002761 11:37695380-37695402 AGAAATTTTCCCCATTGTCTTGG - Intergenic
1081167317 11:39822088-39822110 CAAAATATTCCCCCTTGTGTGGG + Intergenic
1082085554 11:48046730-48046752 TGTAATAATCCACATAGGGTAGG - Intronic
1082748516 11:56994154-56994176 AGATATATTCCCCATTGTCTGGG + Intergenic
1084340432 11:68495681-68495703 TCAAATAATACTCATTATGTGGG + Intronic
1085773897 11:79348519-79348541 TGAATTAACCCCCACTGTGATGG + Intronic
1086769499 11:90744729-90744751 AGAAATTTTCCCCATTGTCTTGG - Intergenic
1086774885 11:90818235-90818257 TAAAATAATCAATATTGTGTAGG - Intergenic
1088013980 11:105037350-105037372 AGACATATTCCCCATTGTCTTGG - Intergenic
1089294245 11:117458457-117458479 AGAAAGAATGCCCATGGTGTGGG + Intronic
1089511739 11:119003012-119003034 TGAGATGATCCCTATTTTGTTGG + Intronic
1093486165 12:19655589-19655611 AGACTTAATCCCCATTGTGGTGG + Intronic
1094270841 12:28612417-28612439 TGAAATAATGCACATTGTACTGG + Intergenic
1095039658 12:37427201-37427223 AGAAATTTTCCCCATTGTTTTGG - Intergenic
1097325490 12:58271758-58271780 TGAGATAGTCCCTATTCTGTGGG + Intergenic
1097409458 12:59233380-59233402 TGAAATCATTCTCATTGTGTAGG - Intergenic
1098267649 12:68738659-68738681 TGGAATAGTCCCCTTAGTGTTGG + Intronic
1099586971 12:84531530-84531552 TTAATTAATCACTATTGTGTTGG - Intergenic
1099907787 12:88792324-88792346 AGACATATTCCCCATTGTCTTGG - Intergenic
1102032283 12:109747668-109747690 TGAAATCTTCCACATTGTGTTGG + Intronic
1104523697 12:129498683-129498705 TGAAATATTCCGCTTGGTGTAGG + Intronic
1105519926 13:21122773-21122795 TTGAATAGTCCCCACTGTGTTGG + Intergenic
1105567124 13:21560675-21560697 TGCAATAATCCCAATGGGGTAGG - Intronic
1106631585 13:31479689-31479711 AGACATTTTCCCCATTGTGTTGG + Intergenic
1107211868 13:37868394-37868416 TGAAATCTTCATCATTGTGTTGG - Intronic
1108812294 13:54242570-54242592 TGAAAGAATCAACATTATGTTGG + Intergenic
1108935628 13:55877378-55877400 TAAAATTAATCCCATTGTGTGGG - Intergenic
1109207541 13:59498852-59498874 TGTAAAAATCCCCATTGTAATGG - Intergenic
1111244733 13:85521449-85521471 TGAAGTTATGCACATTGTGTGGG + Intergenic
1112161213 13:96870058-96870080 AGATATTTTCCCCATTGTGTAGG + Intergenic
1113280467 13:108782581-108782603 AGAAATTTTCCCCATTGTCTTGG - Intronic
1114778724 14:25515054-25515076 AGACATTATCCCCATTGTCTCGG + Intergenic
1114989804 14:28272635-28272657 TGACATTTTCCCCATTGTCTTGG + Intergenic
1115085833 14:29513553-29513575 TGACATTTTCCCCATTGTCTTGG + Intergenic
1115277252 14:31622438-31622460 AGAAATTCTCCCCATTGTCTCGG - Intronic
1115324390 14:32122436-32122458 TAAAATATTCTCCATTCTGTGGG + Intronic
1117749175 14:58902814-58902836 AGAAATTTTCCCCATTGTCTTGG - Intergenic
1118460030 14:65979327-65979349 AGACATTTTCCCCATTGTGTTGG - Intronic
1118532942 14:66727883-66727905 TGACATTTTCCCCATTGTATTGG - Intronic
1120721373 14:87892793-87892815 AAAATTAATCCCCATTGTGGTGG - Intronic
1121384822 14:93510277-93510299 AGAAATTTTCCCCATTGTCTTGG + Intronic
1122994587 14:105256210-105256232 GAAAATAATCTCCTTTGTGTAGG + Intronic
1124860284 15:33432955-33432977 GGAAATAATGTCCATTGTGTGGG + Intronic
1126185132 15:45824044-45824066 TGACATTTTCCCCATTGTCTTGG + Intergenic
1126275935 15:46881043-46881065 TAAATTCATCCACATTGTGTAGG - Intergenic
1126514954 15:49524135-49524157 TGACATTTTCCCCATTCTGTTGG - Intronic
1126647951 15:50894086-50894108 AGACATTTTCCCCATTGTGTTGG - Intergenic
1126929268 15:53629875-53629897 TGAAATATTGCCAATTTTGTGGG - Intronic
1127559558 15:60122350-60122372 TGAAATTGTCCCAACTGTGTGGG - Intergenic
1128192279 15:65714048-65714070 TAAAATGAACCCCATAGTGTTGG - Intronic
1128443362 15:67735255-67735277 AGACATCATCCCCAATGTGTGGG + Intronic
1129572011 15:76697969-76697991 TGTAATAATTCCCATTGTAAAGG - Intronic
1129620124 15:77136829-77136851 AGAAATATTTCCCATTGTCTTGG - Intronic
1130968352 15:88713861-88713883 TGTAATAATCCCCTGTGAGTTGG - Intergenic
1131444242 15:92483218-92483240 TGATATAATCCCATTTGTTTTGG - Intronic
1131582145 15:93654516-93654538 CAACATAATCCCCACTGTGTTGG - Intergenic
1131679241 15:94704106-94704128 TGAAAATAACCCCATTGTTTGGG - Intergenic
1133075521 16:3277651-3277673 TGAAATAATCCTAATTGAGAAGG - Intronic
1135505936 16:23036283-23036305 TGAAAACATCCCTGTTGTGTTGG + Intergenic
1138268121 16:55675031-55675053 TTAAATAATAGCCATTCTGTTGG + Intronic
1138437214 16:57009724-57009746 TAAATTTATCCTCATTGTGTTGG - Intronic
1138441846 16:57040054-57040076 TGAAAGGAGCCCCAGTGTGTAGG + Intronic
1140187035 16:72783666-72783688 TGAAATAACTCCCATTCTGTGGG + Exonic
1143567980 17:7736609-7736631 TGAAATGATCGCTACTGTGTAGG + Intronic
1143750753 17:9025285-9025307 TGAAATAATCTCTATAGTTTGGG + Intronic
1144388049 17:14768449-14768471 TGAAATTTTCCCCATGGTTTAGG + Intergenic
1144538575 17:16115332-16115354 AGAAATTTTCCCCATTGTCTTGG + Intronic
1144874095 17:18388131-18388153 TCAAATAATACCCATAGTGTAGG + Intronic
1145158125 17:20556285-20556307 TCAAATAATACGCATAGTGTAGG - Intergenic
1146551971 17:33788367-33788389 TTTAATAATCACCATTCTGTCGG - Intronic
1147654281 17:42080012-42080034 TGAAATAATTTCTGTTGTGTTGG - Intergenic
1149244677 17:54691650-54691672 TGCAAAAATTCCCATTCTGTAGG - Intergenic
1149260656 17:54876826-54876848 AGACATTTTCCCCATTGTGTTGG - Intergenic
1149627105 17:58087633-58087655 TGTAATAATCCTCATCATGTAGG + Intronic
1151135779 17:71944826-71944848 AGACATTTTCCCCATTGTGTTGG - Intergenic
1155057773 18:22200280-22200302 TGAAACAAACCTCACTGTGTGGG - Intronic
1155311311 18:24526661-24526683 TGGAATAATCCCAATGGTATGGG + Intergenic
1155556613 18:27026729-27026751 TGAAGCAATCCCCATTGTTGGGG - Intronic
1157868164 18:51204326-51204348 TGAAATAATATCCATTTAGTTGG - Intronic
1159528305 18:69622917-69622939 TGAAATAAACCCATTTGAGTCGG + Intronic
1163182159 19:15612101-15612123 TTAGATAATCCCAATTTTGTTGG - Intergenic
1164613852 19:29652996-29653018 TGAGACAATCCCCACTGTGGTGG - Intergenic
1165605079 19:37095425-37095447 AAAAATAATGCCCATTTTGTAGG - Intronic
1166557922 19:43713741-43713763 TGCAATAATCTCCATTTTCTCGG + Intergenic
1168215742 19:54924296-54924318 TATAAGGATCCCCATTGTGTGGG - Intronic
925354360 2:3227613-3227635 AGAAATTTTCCCCATTGTGTTGG - Intronic
925821134 2:7801043-7801065 AGACATTTTCCCCATTGTGTTGG - Intergenic
926502506 2:13673511-13673533 AGAAATTTTCCCCATTGTCTTGG + Intergenic
926919546 2:17926812-17926834 AGAAATTTTCCCCATTGTCTTGG + Intronic
928388818 2:30892691-30892713 TGTAATGCTACCCATTGTGTGGG + Intergenic
929735774 2:44547708-44547730 TGAAATAATACCCATTTCATAGG + Intronic
930163249 2:48179028-48179050 AAACATAATCCCTATTGTGTTGG - Intergenic
933047541 2:77557975-77557997 TGACATTCTCCCCATTGTCTTGG - Intronic
933836655 2:86251352-86251374 TGAAATAAACACCAGTCTGTGGG - Intronic
934143341 2:89069606-89069628 TTAAAGAATCCCCAGTGTGAAGG - Intergenic
934153049 2:89168039-89168061 TGAAATCAAATCCATTGTGTTGG - Intergenic
934214191 2:90013892-90013914 TGAAATCAAATCCATTGTGTTGG + Intergenic
934225900 2:90130949-90130971 TTAAAGAATCCCCAGTGTGAAGG + Intergenic
936940817 2:117882628-117882650 AGACATTATCCCCATTGTGTTGG - Intergenic
937518792 2:122685759-122685781 AGACATATTCCCCATTGTCTTGG + Intergenic
939037344 2:137148932-137148954 TGACATTTTCCCCATTGTCTTGG - Intronic
939754668 2:146094517-146094539 AGACATTTTCCCCATTGTGTTGG + Intergenic
940411650 2:153371045-153371067 TTTAATAATCCCAATTGTGTTGG - Intergenic
941029984 2:160500031-160500053 AAACTTAATCCCCATTGTGTTGG + Intergenic
941581382 2:167300643-167300665 TGAAATAATCACAAATATGTGGG + Intergenic
941683222 2:168421324-168421346 TGGAATAATCGCCATTTGGTGGG + Intergenic
943108052 2:183571845-183571867 AGAAATTTTCCCCATTGTCTTGG - Intergenic
943297812 2:186160759-186160781 GGACATTTTCCCCATTGTGTTGG - Intergenic
943463094 2:188194047-188194069 TGAAATAATCACAAATGTGAGGG + Intergenic
943493476 2:188585789-188585811 TGACATCTTCCCCATTGTCTTGG + Intronic
945511366 2:210706914-210706936 TGAAGTAAGCCAAATTGTGTAGG - Intergenic
946511159 2:220357882-220357904 TAAATTATTTCCCATTGTGTGGG + Intergenic
946515445 2:220405872-220405894 AGACATTATCCCCATTGTCTTGG + Intergenic
946562270 2:220926541-220926563 AGACATCATCCCCATTGTGTTGG + Intergenic
946803728 2:223449208-223449230 GGAAATCATCCCCATTGGGAGGG - Intergenic
947120799 2:226812578-226812600 TGGAACAATCCCCATGGTGGGGG + Intergenic
1170468060 20:16640864-16640886 TGAAATAATCCTTATTGTCCTGG - Intergenic
1170633558 20:18085453-18085475 AGACATAATGCCCATTGTGGTGG + Intergenic
1172590963 20:36117591-36117613 TATAATTATCCCCATTTTGTGGG + Intronic
1173323483 20:42010395-42010417 AGAAATTTTCCCCATTGTCTTGG + Intergenic
1176342383 21:5710375-5710397 TGAAATTTTCCCCGTAGTGTTGG - Intergenic
1176342387 21:5710418-5710440 TGAAATTATCCCCTCAGTGTTGG - Intergenic
1176474637 21:7142527-7142549 TGAAATTTTCCCCGTAGTGTTGG - Intergenic
1176474641 21:7142570-7142592 TGAAATTATCCCCTCAGTGTTGG - Intergenic
1176502440 21:7614038-7614060 TGAAATTATCCCCTCAGTGTTGG + Intergenic
1176502444 21:7614081-7614103 TGAAATTTTCCCCGTAGTGTTGG + Intergenic
1176536704 21:8108444-8108466 TGAAATTTTCCCCGTAGTGTTGG - Intergenic
1176536708 21:8108487-8108509 TGAAATTATCCCCTCAGTGTTGG - Intergenic
1177334613 21:19707507-19707529 TGACATTTTCCCCATTGTCTTGG - Intergenic
1177606135 21:23379746-23379768 TGTAATAATCCCCATGGTCAAGG + Intergenic
1178466291 21:32851448-32851470 TGAAATAATTATCATAGTGTTGG - Intergenic
1180573612 22:16752312-16752334 AGAAATTTTCCCCATTGTTTTGG - Intergenic
1182182307 22:28363068-28363090 TGACATTTTCCCCATTGTCTTGG - Intronic
1183114451 22:35679601-35679623 TGTAATAATCCCCAATGTCGTGG + Intergenic
1184969920 22:48010912-48010934 TGATATAATTCTCATTGTATGGG + Intergenic
1184971686 22:48026856-48026878 TGAAATAATCACCAAGGTGAGGG + Intergenic
1203241652 22_KI270733v1_random:24855-24877 TGAAATTTTCCCCGTAGTGTTGG - Intergenic
1203241656 22_KI270733v1_random:24898-24920 TGAAATTATCCCCGCAGTGTTGG - Intergenic
954605441 3:51905881-51905903 AGACATATTCCCCATTGTCTTGG - Intergenic
955764859 3:62332185-62332207 TGGAGTAACTCCCATTGTGTGGG - Intronic
956021502 3:64938243-64938265 AGAAAGAATCCCCTTTGAGTTGG + Intergenic
956169594 3:66422172-66422194 AGACATATTCCCCATTGTCTTGG + Intronic
956354608 3:68377643-68377665 AGACATTTTCCCCATTGTGTTGG - Intronic
956702593 3:71971637-71971659 TGATAAATTCCCCATTATGTGGG - Intergenic
956947132 3:74235339-74235361 AGACATATTCCCCATTGTCTTGG + Intergenic
957654906 3:83061460-83061482 AGACATATTCCCCATTGTCTCGG + Intergenic
958152149 3:89704378-89704400 AGATATATTCCCCATTGTCTTGG + Intergenic
958577663 3:95973746-95973768 AGACATATTCCCCATTGTTTTGG - Intergenic
959235712 3:103718940-103718962 AGACATTTTCCCCATTGTGTTGG + Intergenic
959569602 3:107868662-107868684 AGAAAGAAACCCTATTGTGTTGG + Intergenic
960060169 3:113312560-113312582 AGATATATTCCCCATTGTCTTGG - Intronic
961545866 3:127632538-127632560 TTAAATAATACACATTGTATAGG - Intronic
961961523 3:130860560-130860582 TGGTATTATCCCCATTTTGTGGG + Intronic
962646469 3:137445390-137445412 AGACATTTTCCCCATTGTGTTGG + Intergenic
962703841 3:138024985-138025007 TTACATAAGCCCCATTGTGGTGG + Intronic
962912206 3:139863249-139863271 TGGGATAATGCCTATTGTGTAGG - Intergenic
963281247 3:143386489-143386511 TCTAATTATCCCCATTGTATTGG - Intronic
963391801 3:144674236-144674258 TAAACTAATCCCCATTGTGATGG + Intergenic
963463887 3:145653114-145653136 TAAAACAGTCCCCATTGAGTTGG + Intergenic
963808148 3:149747245-149747267 TTAAATAATCCCCATATTCTTGG - Intronic
964498190 3:157317951-157317973 AGAAATAATACCCATCTTGTAGG - Intronic
964926356 3:161963362-161963384 TGACATCTTCCCCATTGTCTTGG - Intergenic
965203690 3:165693128-165693150 AGACATTATCCCCATTGTCTTGG + Intergenic
966333450 3:178840840-178840862 AGACATTTTCCCCATTGTGTTGG + Intronic
967453858 3:189658167-189658189 TGAAATCATTCCCTTTTTGTGGG - Intronic
970336572 4:15051766-15051788 TGAAGTAATCCCCACTCTGTGGG - Intronic
970577774 4:17444478-17444500 AGAAATTTTCCCCATTGTCTTGG + Intergenic
970808126 4:20059930-20059952 TCCCATAATTCCCATTGTGTGGG - Intergenic
971187962 4:24399395-24399417 TGAAATTTCTCCCATTGTGTAGG - Intergenic
972317249 4:37938350-37938372 TGTAATATTCTTCATTGTGTTGG + Intronic
972993553 4:44851988-44852010 AGAAATTTTCCCCATTGTCTTGG - Intergenic
973099597 4:46249075-46249097 TGAAATAATCCACAATCTATTGG + Exonic
975729285 4:77321552-77321574 AGACATATTCCCCATTGTCTTGG + Intronic
976635931 4:87286562-87286584 TGACATTTTCCCCATTGTCTTGG - Intergenic
978376521 4:108079968-108079990 TGAGAAAATTCCCATTGTGATGG - Intronic
979467120 4:121053392-121053414 TGAAGTAATTCTGATTGTGTAGG - Intronic
980333975 4:131444946-131444968 TGAAATCTTCCCCAGTGTGATGG + Intergenic
980586607 4:134825428-134825450 AAATATAATCCCCAATGTGTTGG + Intergenic
981820419 4:148880554-148880576 TGACATTTTCCCCATTGTCTTGG + Intergenic
981983284 4:150823389-150823411 TTATATAATCCCCAGTCTGTGGG + Intronic
982309947 4:153974506-153974528 AGAAATTTTCCCCATTGTCTTGG - Intergenic
982476037 4:155852080-155852102 TGAAATAATATCCAATGTGTGGG + Intronic
982609047 4:157550986-157551008 GGAAATTTTCCCCATTGTCTTGG - Intergenic
983847362 4:172536860-172536882 TGACATTTTCCCCATTGTCTTGG - Intronic
985304261 4:188521755-188521777 AGATATATTCCCCATTGTCTTGG - Intergenic
987655191 5:20797357-20797379 AGATATTATCCCCATTGTCTTGG + Intergenic
989399461 5:40993256-40993278 AGACATATTCCCCATTGTCTTGG + Intergenic
989731394 5:44654228-44654250 AGACATTTTCCCCATTGTGTTGG + Intergenic
989746773 5:44839114-44839136 AGACATATTCCCCATTGTCTTGG - Intergenic
990801386 5:59607960-59607982 AGAAATAAACCACACTGTGTAGG - Intronic
990924819 5:61008567-61008589 TGAAATCATCCGCATTTTATAGG - Intronic
991119481 5:62994464-62994486 AGACATTTTCCCCATTGTGTGGG + Intergenic
993545000 5:89201040-89201062 CGTAATAATCCCCATTTTATAGG + Intergenic
994388485 5:99161448-99161470 TGAAATAATACCTATTGCATAGG - Intergenic
994576445 5:101585708-101585730 AGACATATTCCCCATTGTCTTGG - Intergenic
994656011 5:102593664-102593686 AGACATTATCCCCATTGTGTTGG + Intergenic
994813981 5:104559784-104559806 TAAAATAAACCCCATTGTGTTGG - Intergenic
994849532 5:105036279-105036301 AGACATTTTCCCCATTGTGTTGG + Intergenic
994878944 5:105461248-105461270 TGACATTTTCCCCATTGTCTTGG + Intergenic
995129232 5:108612569-108612591 AGAAATTTTCCCCATTGTCTTGG - Intergenic
995198930 5:109404762-109404784 AAACATAATCCCCATTGTGAGGG - Intronic
995390923 5:111639748-111639770 AGACATTATCCCCATTGTCTTGG - Intergenic
995926824 5:117385230-117385252 AAACATAATCCCCATTGTGGTGG + Intergenic
998478004 5:142437556-142437578 CTATATCATCCCCATTGTGTTGG + Intergenic
998871555 5:146557496-146557518 AGAAATTTTCCCCATTGTCTTGG + Intergenic
999662052 5:153874640-153874662 TGAAACAATCCCCATTGTGGTGG - Intergenic
1000146035 5:158454369-158454391 TTTGATAATCCCCAGTGTGTAGG + Intergenic
1000308398 5:160017504-160017526 TGAAATAATCCCCATTGTGTTGG - Intronic
1000442138 5:161276575-161276597 TTGAATAACCCCCATTGTGATGG - Intergenic
1000564949 5:162835226-162835248 TGACATTTTCCCCATTGTCTTGG + Intergenic
1000805180 5:165781791-165781813 TGAAACACTGCCCATTTTGTGGG + Intergenic
1001905433 5:175468464-175468486 TGAAATCATTTCCATTCTGTGGG + Intergenic
1003008275 6:2402378-2402400 TAAAATAATCACCATTGGCTGGG + Intergenic
1004461710 6:15842777-15842799 TGAAGAGATCCCCATTGTGACGG - Intergenic
1004718748 6:18245817-18245839 TGTAATAATCCCCACGTTGTGGG + Intronic
1007204663 6:40138905-40138927 TAATGTAATCCCCATTGTGCAGG - Intergenic
1008939180 6:57028184-57028206 TGAAATGATCACCTCTGTGTAGG - Intergenic
1009391135 6:63145501-63145523 AGAAATTTTCCCCATTGTCTTGG - Intergenic
1009637532 6:66285120-66285142 AGACATATTCCCCATTGTCTTGG - Intergenic
1009757262 6:67956161-67956183 AGTAATTATCCCCATTGTCTTGG - Intergenic
1010061198 6:71625189-71625211 AGACATTATCCCCATTGTCTTGG - Intergenic
1011031675 6:82930903-82930925 AGAAATTTTCCCCATTGTCTTGG - Intronic
1011088561 6:83570468-83570490 AGACATTTTCCCCATTGTGTTGG - Intronic
1011382223 6:86754717-86754739 TGAAATATTCTCAATTGTTTTGG + Intergenic
1011543743 6:88462505-88462527 TGAAAAACTAACCATTGTGTAGG + Intergenic
1012276600 6:97282577-97282599 TGAAGTAATCCCCACTCTCTCGG - Intronic
1012767417 6:103386607-103386629 AGACATTTTCCCCATTGTGTTGG - Intergenic
1013558822 6:111283944-111283966 AGACATTTTCCCCATTGTGTTGG + Intergenic
1014459549 6:121679972-121679994 TTAAATTATCCCAATTTTGTTGG + Intergenic
1014895150 6:126892534-126892556 AGACATATTCCCCATTGTCTTGG - Intergenic
1015466029 6:133549620-133549642 TTTATTAATCCCCATTTTGTTGG - Intergenic
1015476051 6:133659765-133659787 TGAAATATGCTCCATTGCGTGGG + Intergenic
1016628312 6:146198558-146198580 TGAAAAAATCACCATTGGGTAGG + Intronic
1018646210 6:165951105-165951127 TGAAATAAGCCACACTGTTTAGG + Intronic
1020039023 7:4987305-4987327 TGACTTAATCCCCAGTGTGGCGG - Intronic
1021537070 7:21717439-21717461 TGAAACTATTCCCATAGTGTAGG - Intronic
1022607804 7:31833889-31833911 TGACATTTTCCCCATTGTCTTGG - Intronic
1024414523 7:49088924-49088946 TGAAATCTTTCACATTGTGTGGG + Intergenic
1026225663 7:68437875-68437897 GGAAATAATTCCAATGGTGTGGG - Intergenic
1027743382 7:82041017-82041039 TGAACTCATCCACATTATGTAGG + Intronic
1028314444 7:89383417-89383439 AGACATATTCCCCATTGTCTTGG - Intergenic
1028885605 7:95929116-95929138 GAAAATCATCCACATTGTGTGGG - Intronic
1030207566 7:106965802-106965824 TGAAATAATCCCCCTTCTATTGG - Intergenic
1031396972 7:121285353-121285375 TGACATTTTCCCCATTGTCTTGG + Intronic
1031888271 7:127263269-127263291 TGAAATATTCACCAATGTGAGGG - Intergenic
1032514060 7:132493950-132493972 TGTAATAATCCCCATTCTACAGG - Intronic
1034840775 7:154393532-154393554 TTGAACAATCTCCATTGTGTGGG - Intronic
1037284934 8:17289130-17289152 AGAAATTTTCCCCATTCTGTAGG + Intronic
1037644464 8:20779599-20779621 TGAGATAATCACATTTGTGTAGG + Intergenic
1039652087 8:39353291-39353313 AGATATATTCCCCATTGTCTTGG - Intergenic
1039690076 8:39853571-39853593 TGAAATAATACCTATTGAATGGG - Intergenic
1040022220 8:42750921-42750943 TGGTATAATTACCATTGTGTTGG - Intergenic
1042865976 8:73357021-73357043 TTTAATAATCCACATTGTTTGGG + Intergenic
1045736076 8:105297277-105297299 TGACATTTTCCCCATTGTTTTGG + Intronic
1046052953 8:109044960-109044982 AGATATATTCCCCATTGTCTTGG + Intergenic
1046258398 8:111731874-111731896 TGAAAGAATGCACATTGTATGGG + Intergenic
1047871632 8:129089362-129089384 TGAAATGGTCCCCATTGTTAGGG - Intergenic
1048243612 8:132768789-132768811 TGAAATAATTCCCCTTCTGCAGG - Intergenic
1048404532 8:134106597-134106619 AGACATTATCCCCATTGTCTTGG - Intergenic
1048915794 8:139181831-139181853 AGACATATTCCCCATTGTCTTGG - Intergenic
1049076252 8:140398837-140398859 TGACATTTTCCCCATTGTCTTGG - Intronic
1050495728 9:6239727-6239749 TGAAATAGGCCTCATTGTCTGGG - Intronic
1050549041 9:6733301-6733323 AGAAATAAGCCCCTTTCTGTAGG - Intronic
1051092890 9:13431082-13431104 TGAAAGAAGCCCCATCATGTGGG - Intergenic
1051329850 9:16012769-16012791 TGAGATATTCCCCAGTGTCTGGG + Intronic
1052054020 9:23882976-23882998 AGAAATTTTCCCCATTGTCTTGG + Intergenic
1052294514 9:26882246-26882268 TGACATTTTCCCCATTGTCTTGG - Intronic
1055701226 9:78947894-78947916 AGACATTTTCCCCATTGTGTTGG - Intergenic
1056458563 9:86787160-86787182 TTATAGAATCCCCATTGTATAGG - Intergenic
1060531327 9:124348575-124348597 TAATATTATCCCCATTGTATAGG - Intronic
1203440512 Un_GL000219v1:3453-3475 TGAAATATTCTCCATCGTATAGG - Intergenic
1203457973 Un_GL000220v1:7930-7952 TGAAATTTTCCCCGTAGTGTTGG - Intergenic
1203457977 Un_GL000220v1:7973-7995 TGAAATTATCCCCTCAGTGTTGG - Intergenic
1203498865 Un_GL000224v1:179596-179618 TGAAATATTCTCCATCGTATAGG - Intergenic
1203511391 Un_KI270741v1:121836-121858 TGAAATATTCTCCATCGTATAGG - Intergenic
1186043760 X:5510813-5510835 TGAAATAATTCACCTTGTCTGGG - Intergenic
1188824308 X:34811350-34811372 TGAGCTATTCCCCACTGTGTCGG + Intergenic
1188962821 X:36513689-36513711 AGAAATAGTTCCCATTCTGTTGG - Intergenic
1189287454 X:39861603-39861625 TGGACAAATCCCCATTGTGTGGG + Intergenic
1193387356 X:80886771-80886793 AGACATTTTCCCCATTGTGTTGG + Intergenic
1193482387 X:82043917-82043939 AGACATATTCCCCATTGTCTTGG - Intergenic
1194132227 X:90095539-90095561 AGAAATTTTCCCCATTGTCTTGG - Intergenic
1194886075 X:99318001-99318023 AGACATATTCCCCATTGTCTTGG - Intergenic
1197054226 X:122097688-122097710 AGAAATTTTCCCCATTGTCTTGG - Intergenic
1197282988 X:124559687-124559709 TCATTTAATCCCCATTATGTAGG - Intronic
1197539775 X:127743669-127743691 TAAAATAATCCCTATTGTGGTGG - Intergenic
1199370439 X:147042050-147042072 AGAAATTTTCCCCATTGTCTTGG - Intergenic
1199928696 X:152496048-152496070 TGTAATAATCCCCACTGTCAAGG - Intergenic