ID: 1000312591

View in Genome Browser
Species Human (GRCh38)
Location 5:160059611-160059633
Sequence TTGTTGTGGCTTAGGGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000312587_1000312591 -10 Left 1000312587 5:160059598-160059620 CCTAATTTCAATATTGTTGTGGC 0: 2
1: 211
2: 581
3: 681
4: 686
Right 1000312591 5:160059611-160059633 TTGTTGTGGCTTAGGGAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000312591 Original CRISPR TTGTTGTGGCTTAGGGAAGA GGG Intronic
No off target data available for this crispr