ID: 1000312591 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 5:160059611-160059633 |
| Sequence | TTGTTGTGGCTTAGGGAAGA GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1000312587_1000312591 | -10 | Left | 1000312587 | 5:160059598-160059620 | CCTAATTTCAATATTGTTGTGGC | 0: 2 1: 211 2: 581 3: 681 4: 686 |
||
| Right | 1000312591 | 5:160059611-160059633 | TTGTTGTGGCTTAGGGAAGAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1000312591 | Original CRISPR | TTGTTGTGGCTTAGGGAAGA GGG | Intronic | ||
| No off target data available for this crispr | |||||