ID: 1000314708

View in Genome Browser
Species Human (GRCh38)
Location 5:160078573-160078595
Sequence CTGTGCTAGTAGAAGGCTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 124}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000314708_1000314710 -3 Left 1000314708 5:160078573-160078595 CCAACAGCCTTCTACTAGCACAG 0: 1
1: 0
2: 1
3: 14
4: 124
Right 1000314710 5:160078593-160078615 CAGACTAGCCTACAGTTTTAAGG No data
1000314708_1000314712 21 Left 1000314708 5:160078573-160078595 CCAACAGCCTTCTACTAGCACAG 0: 1
1: 0
2: 1
3: 14
4: 124
Right 1000314712 5:160078617-160078639 ACAAATTTATATACAGAGCCAGG 0: 1
1: 0
2: 1
3: 24
4: 292

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000314708 Original CRISPR CTGTGCTAGTAGAAGGCTGT TGG (reversed) Intronic
900252703 1:1679402-1679424 CTGTGCTCCAAGAAGCCTGTGGG + Intronic
900599333 1:3496433-3496455 CAGAGCTAGCAGAAGCCTGTGGG + Intronic
901063591 1:6484969-6484991 CTGGGGTAGGAGGAGGCTGTGGG + Intronic
904654258 1:32031672-32031694 CTGGGCAAGTAGAAGGCATTAGG - Intronic
908418036 1:63932435-63932457 CTGAACTAGAAAAAGGCTGTTGG + Intronic
909611096 1:77552557-77552579 CTGTGATAGTAAAAGGCAGAAGG + Intronic
912387793 1:109280993-109281015 AGTTGCTGGTAGAAGGCTGTGGG + Exonic
919683989 1:200464531-200464553 CTGTGGCAGTACAAGGCTGAAGG - Intergenic
922656810 1:227392331-227392353 CTTAGCTAGTAGGAAGCTGTGGG - Intergenic
923015839 1:230126226-230126248 CTGTGCTAGGAGAGGGCTGTAGG + Intronic
923570042 1:235105265-235105287 CTGTGGGAGAGGAAGGCTGTGGG + Intergenic
924387571 1:243513273-243513295 CTGTGCTAGAAGGAACCTGTGGG - Intronic
924577967 1:245297719-245297741 CTGTGCTAGTTGATGGGAGTGGG + Intronic
1063941790 10:11137406-11137428 CCGTGTTAGTACAATGCTGTGGG + Intronic
1065524029 10:26599838-26599860 CTGTCCTAATAGAAGTATGTAGG - Intergenic
1067383661 10:45798569-45798591 TTGTGATAGGAGAAGGCTGTGGG + Intergenic
1067880518 10:50040232-50040254 TTGTGATAGGAGAAGGCTGTGGG - Intergenic
1067891363 10:50139136-50139158 TTGTGATAGGAGAAGGCTGTGGG + Intergenic
1069280091 10:66644910-66644932 CTGAGCTAGCAGGAGGATGTGGG - Intronic
1070482154 10:76893188-76893210 ATGTAATAATAGAAGGCTGTGGG + Intronic
1074653041 10:115546678-115546700 CTGGGCTAGGAAAATGCTGTTGG + Intronic
1075934501 10:126327839-126327861 CTGTGGAAGTAGTAGCCTGTAGG - Intronic
1076343718 10:129766655-129766677 CTGTGCCAGGGGCAGGCTGTTGG - Intronic
1078418656 11:11188372-11188394 CTGTGTTAGTTGGAGACTGTGGG - Intergenic
1079336950 11:19578332-19578354 ATTTGCTAGTAGAAGGCTCTTGG + Intronic
1081303842 11:41486964-41486986 TTGTGGTAGTAGAGGCCTGTTGG - Intergenic
1085564463 11:77500866-77500888 CTGTGGTAAGAGAAGTCTGTTGG - Intergenic
1087105904 11:94406587-94406609 CTGTCTTAGTACTAGGCTGTAGG - Intergenic
1092576591 12:9790682-9790704 CTGTTATATTAGAAGGCTGGAGG - Intergenic
1093512663 12:19947540-19947562 CTGTGGTAGTGGTAGGGTGTGGG + Intergenic
1096695663 12:53346507-53346529 CTGGGGTAGAGGAAGGCTGTGGG + Intergenic
1099059708 12:77891945-77891967 CTGGTCTAGTAGAAGCCTGTGGG + Intronic
1102262604 12:111453620-111453642 CTGTGCGAGCAGAATGCTTTGGG + Intronic
1104202105 12:126599675-126599697 CTGTGCTCGCAGTAGACTGTGGG + Intergenic
1109339460 13:61036810-61036832 CTGTGCTTATAGAAACCTGTTGG + Intergenic
1111178851 13:84635827-84635849 CTGTGGTAGGAGGAGGCTGTAGG - Intergenic
1111568588 13:90048317-90048339 CTGTGCTGGTGAAAGACTGTGGG - Intergenic
1112042105 13:95556787-95556809 CTGTGCTAGTTGATGGATTTAGG - Intronic
1112760960 13:102692809-102692831 CTGCCCTGGTAGGAGGCTGTAGG + Intronic
1115346724 14:32350885-32350907 CTGTGCTATTAGAATGGGGTAGG - Intronic
1120048414 14:79835781-79835803 CTGTGCAAGTATAAGGATTTAGG + Intronic
1124431486 15:29612476-29612498 CTCTGCTGGTAGCAGGCTGAAGG - Intergenic
1124560682 15:30770825-30770847 CTGTGCCGGGAGAAGCCTGTAGG + Intronic
1124652676 15:31484924-31484946 CTGCGGTAGTAAAAGGATGTAGG + Intronic
1124670526 15:31634618-31634640 CTGTGCCGGGAGAAGCCTGTAGG - Intronic
1124831950 15:33157561-33157583 GTTTGTTAGTAGAAGGCAGTAGG - Intronic
1126883092 15:53120195-53120217 CTGTGCCACTAGAAGTGTGTAGG - Intergenic
1129736958 15:77971988-77972010 CTGTCCTAGAACCAGGCTGTTGG - Intergenic
1129849113 15:78781633-78781655 CTGTCCTAGAACCAGGCTGTTGG + Intronic
1133236559 16:4389913-4389935 CTGTGCTAGGAGCTGGCAGTGGG + Intronic
1133278390 16:4651590-4651612 CTGTGCTCGTAGGAAGCTTTGGG + Intronic
1137476820 16:48816722-48816744 CTGGGCTATTAGGAGGATGTTGG - Intergenic
1141989940 16:87603724-87603746 CTGTGCCAGCTGAAGGGTGTTGG + Intronic
1143320688 17:6066906-6066928 CTATGTTAGTAGATGGCTGCTGG - Intronic
1149599840 17:57886045-57886067 CTGTGCTAGTAAAGAACTGTGGG - Intronic
1150735677 17:67736092-67736114 CTTTACAAATAGAAGGCTGTGGG - Intronic
1153651314 18:7242688-7242710 ATTGGCTAGTAGAAGGCTTTAGG + Intergenic
1157492514 18:48134363-48134385 CTGTCCTAATAGAATGGTGTTGG - Intronic
1160311005 18:77790069-77790091 CTGTGGGAGCAGAAGGCTGCAGG + Intergenic
1165312487 19:35037249-35037271 CTGTGTTAGGAGAAGGCAGATGG + Intronic
925034527 2:675692-675714 CTGCGCTGGGAGAAGGCTGTGGG - Intronic
925578082 2:5381161-5381183 CCGTGCTAGAAGAAGGCTCTGGG + Intergenic
926017013 2:9462193-9462215 CTGTGCTCTTAGAAGGATGGGGG - Intronic
926222639 2:10946361-10946383 CTGTGCTTCCAGTAGGCTGTAGG - Intergenic
926380859 2:12287858-12287880 TTGACCTAGTAAAAGGCTGTTGG + Intergenic
928445808 2:31332522-31332544 CTGTGCTACTAAAGGGCCGTAGG + Intergenic
929226334 2:39515105-39515127 CTGTACTAGTAGCAGCCGGTGGG + Intergenic
929441699 2:41970295-41970317 CTGGGCCAGTAGAAGACTGAGGG + Intergenic
930414725 2:51077067-51077089 CTGGGCAACTAGAAGGCTGTGGG + Intergenic
931919521 2:66998258-66998280 CTATACTACTACAAGGCTGTAGG - Intergenic
932293887 2:70608485-70608507 CTGTGCAAGTAGATGGGTTTCGG - Intronic
933984694 2:87580868-87580890 CTCTGGTAAAAGAAGGCTGTGGG + Intergenic
936309157 2:111369932-111369954 CTCTGGTAAAAGAAGGCTGTGGG - Intergenic
939363064 2:141198661-141198683 CTGTGCTAGAAGAAGGAATTGGG - Intronic
945854955 2:215058147-215058169 CTGGGCTAATAGAAGGCTGAAGG - Intronic
948967232 2:241392279-241392301 CTTTGCCAGTAGAGGGCTCTGGG - Intronic
1169483926 20:6010402-6010424 TCATGCTAGCAGAAGGCTGTAGG + Intronic
1172590582 20:36114903-36114925 CCGGGGGAGTAGAAGGCTGTTGG + Intronic
1174758180 20:53180622-53180644 CAGTGTTAGGAGAAGGATGTTGG - Intronic
1179106318 21:38403797-38403819 CTGTGCTTGTGGAAGGCAGCTGG - Intronic
1179572288 21:42284814-42284836 ATGAGCTAACAGAAGGCTGTGGG - Intronic
950247455 3:11434394-11434416 GTGAGCTAGCAGAAGGCTCTGGG - Intronic
950943157 3:16915103-16915125 CTGTCTTAGTAGACGGATGTTGG + Intronic
952970077 3:38645237-38645259 CTGGGCTGGCAGCAGGCTGTGGG + Intronic
953013558 3:39051813-39051835 CTGTGCAAGTATAATGCTGATGG - Intergenic
953476669 3:43211356-43211378 CTCTGCTAGGAAAAAGCTGTGGG - Intergenic
956346855 3:68288836-68288858 CTCTGCTAGTACTAGCCTGTAGG + Intronic
956890348 3:73607133-73607155 CTGAGCTAGAAGAAAGCGGTTGG - Intronic
963131273 3:141860474-141860496 CTCTGCTAGTACCAGCCTGTTGG + Intergenic
963560055 3:146853879-146853901 CTGTGCTAGAAGCAAGCTGTTGG + Intergenic
963835344 3:150053194-150053216 CTCTGCTACTAGCAAGCTGTTGG - Intergenic
964534200 3:157701652-157701674 CTGTGCTAGTACAGCGCTGGAGG - Intergenic
968190625 3:196664670-196664692 CTGTGACTTTAGAAGGCTGTGGG + Intronic
968572525 4:1349550-1349572 CTGTGCTATCAGCAGGCGGTAGG - Exonic
968946030 4:3664794-3664816 CTGTGCAAGTTGGAGGCAGTTGG + Intergenic
970594343 4:17586110-17586132 CTGTGTCAGTGGGAGGCTGTTGG + Intronic
970914284 4:21314533-21314555 CTGTGGTTGTAGGAGGCTGAAGG + Intronic
974020268 4:56686906-56686928 CTGTGCTAGTAGAAAGCAGGGGG + Intergenic
977807789 4:101323303-101323325 CTGTGCTACTATAGGGCTTTGGG + Intronic
979270681 4:118757094-118757116 CTGTGCTTTAAAAAGGCTGTTGG - Intronic
981563490 4:146073320-146073342 CTGGGATGGGAGAAGGCTGTGGG - Intergenic
984482529 4:180324205-180324227 TTGTGCTAGTAACATGCTGTTGG + Intergenic
984912366 4:184686260-184686282 CAGGGCTGGGAGAAGGCTGTGGG + Intronic
986301400 5:6481250-6481272 CTGTCTTAGGAGCAGGCTGTGGG - Intronic
992160897 5:74000746-74000768 CCCTGCTAGTTGAAGACTGTGGG + Intergenic
994192627 5:96885146-96885168 CTGGGCTACTAGAAGGCTGGTGG - Intronic
997575014 5:134968124-134968146 ATGTGCTAGTAGAAGTGTGAGGG + Exonic
999690648 5:154143278-154143300 CAGTGTCAGGAGAAGGCTGTGGG - Intronic
1000314708 5:160078573-160078595 CTGTGCTAGTAGAAGGCTGTTGG - Intronic
1000537217 5:162493727-162493749 CTTTGCTGGTAGAAGGCAGAGGG - Intergenic
1002289059 5:178187367-178187389 CTGTGCTCGGGGAAGGCTGGCGG - Intergenic
1005562509 6:27055012-27055034 CTGTGCTAGTAGTAATCAGTGGG - Intergenic
1006110678 6:31743101-31743123 CTGTGCTCCTGGGAGGCTGTGGG - Exonic
1009204318 6:60783441-60783463 GTTTGCAAGTAGAAGGCTTTTGG - Intergenic
1019102250 6:169641008-169641030 CTGTGCTGGTAGGAGGAGGTGGG - Intronic
1022376283 7:29814518-29814540 ATGTGCTTGTCGAAGGCTGGGGG + Intronic
1023162712 7:37312734-37312756 CTGTGCTAGTAGATGGCCCCTGG - Intronic
1023674034 7:42611926-42611948 CTGTGGTAGTAGAACATTGTGGG + Intergenic
1024318476 7:48043081-48043103 CTATGCTAGGAGAACGGTGTGGG + Intronic
1028086133 7:86639954-86639976 GGGTGGTAGTAGAAGGCTGAAGG - Intergenic
1028710852 7:93905992-93906014 CTGTTCTAGTAGGAGGTTATTGG + Intronic
1029925095 7:104307383-104307405 CTGTGCTAATTGAAGATTGTGGG - Intergenic
1031360495 7:120843783-120843805 CAGAGCTAGCAGAAGACTGTTGG + Intronic
1031608585 7:123798301-123798323 CTGAGCAAGTAGAAGGGTGGAGG - Intergenic
1033810041 7:145001794-145001816 CTGTGGTAGTAGAGGTCTTTGGG + Intergenic
1034210646 7:149359212-149359234 CTGTGGTGGCAGGAGGCTGTGGG - Intergenic
1034851634 7:154499322-154499344 CTGTGCTCCTAGAAGGCAGGGGG - Intronic
1036399830 8:8398192-8398214 CAGTGTTTGTAGAAGGCTCTGGG - Intergenic
1041306011 8:56461735-56461757 CTGTGAAAGTAGAAGGAAGTGGG - Intergenic
1042128779 8:65565737-65565759 CTGTGGTAAGAGAAGGGTGTTGG + Intergenic
1044224635 8:89704880-89704902 TGCTGCTAGTAGAAAGCTGTGGG - Intergenic
1049742356 8:144247262-144247284 CTGGGCTATTAGAATGCTGGGGG - Intronic
1052140882 9:24981507-24981529 GTGTGGAAGAAGAAGGCTGTTGG + Intergenic
1054803565 9:69376964-69376986 CTGTGCTGGTGGGAGGCTGTGGG + Intronic
1054895903 9:70310702-70310724 CTTTTCCAATAGAAGGCTGTTGG + Intronic
1057561817 9:96133745-96133767 GTGTCCTGGTAGGAGGCTGTTGG - Intergenic
1189052993 X:37665988-37666010 CTGAGGTAGGAGAATGCTGTAGG + Intronic
1195206439 X:102604341-102604363 CTGTGCTATTAGTTGTCTGTAGG + Intergenic
1195217089 X:102712859-102712881 CTGTGCCCGGAGAGGGCTGTGGG + Intronic
1199470874 X:148194272-148194294 CTGTGATAGTAGAAAGATTTTGG - Intergenic