ID: 1000320265

View in Genome Browser
Species Human (GRCh38)
Location 5:160129136-160129158
Sequence ATGTTGACATGGGAATTGTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000320265_1000320278 23 Left 1000320265 5:160129136-160129158 CCTAACAATTCCCATGTCAACAT No data
Right 1000320278 5:160129182-160129204 AGGCACCACTGTGGAGGGGGTGG No data
1000320265_1000320280 30 Left 1000320265 5:160129136-160129158 CCTAACAATTCCCATGTCAACAT No data
Right 1000320280 5:160129189-160129211 ACTGTGGAGGGGGTGGTTCTAGG No data
1000320265_1000320272 17 Left 1000320265 5:160129136-160129158 CCTAACAATTCCCATGTCAACAT No data
Right 1000320272 5:160129176-160129198 CCCCACAGGCACCACTGTGGAGG No data
1000320265_1000320268 3 Left 1000320265 5:160129136-160129158 CCTAACAATTCCCATGTCAACAT No data
Right 1000320268 5:160129162-160129184 TCCTCAAAAATTGACCCCACAGG No data
1000320265_1000320274 18 Left 1000320265 5:160129136-160129158 CCTAACAATTCCCATGTCAACAT No data
Right 1000320274 5:160129177-160129199 CCCACAGGCACCACTGTGGAGGG No data
1000320265_1000320270 14 Left 1000320265 5:160129136-160129158 CCTAACAATTCCCATGTCAACAT No data
Right 1000320270 5:160129173-160129195 TGACCCCACAGGCACCACTGTGG No data
1000320265_1000320277 20 Left 1000320265 5:160129136-160129158 CCTAACAATTCCCATGTCAACAT No data
Right 1000320277 5:160129179-160129201 CACAGGCACCACTGTGGAGGGGG No data
1000320265_1000320276 19 Left 1000320265 5:160129136-160129158 CCTAACAATTCCCATGTCAACAT No data
Right 1000320276 5:160129178-160129200 CCACAGGCACCACTGTGGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000320265 Original CRISPR ATGTTGACATGGGAATTGTT AGG (reversed) Intergenic
No off target data available for this crispr