ID: 1000320266

View in Genome Browser
Species Human (GRCh38)
Location 5:160129146-160129168
Sequence TTGAGGAATTATGTTGACAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000320266_1000320278 13 Left 1000320266 5:160129146-160129168 CCCATGTCAACATAATTCCTCAA No data
Right 1000320278 5:160129182-160129204 AGGCACCACTGTGGAGGGGGTGG No data
1000320266_1000320276 9 Left 1000320266 5:160129146-160129168 CCCATGTCAACATAATTCCTCAA No data
Right 1000320276 5:160129178-160129200 CCACAGGCACCACTGTGGAGGGG No data
1000320266_1000320277 10 Left 1000320266 5:160129146-160129168 CCCATGTCAACATAATTCCTCAA No data
Right 1000320277 5:160129179-160129201 CACAGGCACCACTGTGGAGGGGG No data
1000320266_1000320268 -7 Left 1000320266 5:160129146-160129168 CCCATGTCAACATAATTCCTCAA No data
Right 1000320268 5:160129162-160129184 TCCTCAAAAATTGACCCCACAGG No data
1000320266_1000320272 7 Left 1000320266 5:160129146-160129168 CCCATGTCAACATAATTCCTCAA No data
Right 1000320272 5:160129176-160129198 CCCCACAGGCACCACTGTGGAGG No data
1000320266_1000320280 20 Left 1000320266 5:160129146-160129168 CCCATGTCAACATAATTCCTCAA No data
Right 1000320280 5:160129189-160129211 ACTGTGGAGGGGGTGGTTCTAGG No data
1000320266_1000320270 4 Left 1000320266 5:160129146-160129168 CCCATGTCAACATAATTCCTCAA No data
Right 1000320270 5:160129173-160129195 TGACCCCACAGGCACCACTGTGG No data
1000320266_1000320274 8 Left 1000320266 5:160129146-160129168 CCCATGTCAACATAATTCCTCAA No data
Right 1000320274 5:160129177-160129199 CCCACAGGCACCACTGTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000320266 Original CRISPR TTGAGGAATTATGTTGACAT GGG (reversed) Intergenic