ID: 1000320267

View in Genome Browser
Species Human (GRCh38)
Location 5:160129147-160129169
Sequence TTTGAGGAATTATGTTGACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000320267_1000320278 12 Left 1000320267 5:160129147-160129169 CCATGTCAACATAATTCCTCAAA No data
Right 1000320278 5:160129182-160129204 AGGCACCACTGTGGAGGGGGTGG No data
1000320267_1000320277 9 Left 1000320267 5:160129147-160129169 CCATGTCAACATAATTCCTCAAA No data
Right 1000320277 5:160129179-160129201 CACAGGCACCACTGTGGAGGGGG No data
1000320267_1000320272 6 Left 1000320267 5:160129147-160129169 CCATGTCAACATAATTCCTCAAA No data
Right 1000320272 5:160129176-160129198 CCCCACAGGCACCACTGTGGAGG No data
1000320267_1000320268 -8 Left 1000320267 5:160129147-160129169 CCATGTCAACATAATTCCTCAAA No data
Right 1000320268 5:160129162-160129184 TCCTCAAAAATTGACCCCACAGG No data
1000320267_1000320274 7 Left 1000320267 5:160129147-160129169 CCATGTCAACATAATTCCTCAAA No data
Right 1000320274 5:160129177-160129199 CCCACAGGCACCACTGTGGAGGG No data
1000320267_1000320280 19 Left 1000320267 5:160129147-160129169 CCATGTCAACATAATTCCTCAAA No data
Right 1000320280 5:160129189-160129211 ACTGTGGAGGGGGTGGTTCTAGG No data
1000320267_1000320276 8 Left 1000320267 5:160129147-160129169 CCATGTCAACATAATTCCTCAAA No data
Right 1000320276 5:160129178-160129200 CCACAGGCACCACTGTGGAGGGG No data
1000320267_1000320270 3 Left 1000320267 5:160129147-160129169 CCATGTCAACATAATTCCTCAAA No data
Right 1000320270 5:160129173-160129195 TGACCCCACAGGCACCACTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000320267 Original CRISPR TTTGAGGAATTATGTTGACA TGG (reversed) Intergenic
No off target data available for this crispr