ID: 1000320268

View in Genome Browser
Species Human (GRCh38)
Location 5:160129162-160129184
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000320261_1000320268 24 Left 1000320261 5:160129115-160129137 CCCCCTTTTTCTTTGTATATTCC No data
Right 1000320268 5:160129162-160129184 TCCTCAAAAATTGACCCCACAGG No data
1000320265_1000320268 3 Left 1000320265 5:160129136-160129158 CCTAACAATTCCCATGTCAACAT No data
Right 1000320268 5:160129162-160129184 TCCTCAAAAATTGACCCCACAGG No data
1000320267_1000320268 -8 Left 1000320267 5:160129147-160129169 CCATGTCAACATAATTCCTCAAA No data
Right 1000320268 5:160129162-160129184 TCCTCAAAAATTGACCCCACAGG No data
1000320262_1000320268 23 Left 1000320262 5:160129116-160129138 CCCCTTTTTCTTTGTATATTCCT No data
Right 1000320268 5:160129162-160129184 TCCTCAAAAATTGACCCCACAGG No data
1000320266_1000320268 -7 Left 1000320266 5:160129146-160129168 CCCATGTCAACATAATTCCTCAA No data
Right 1000320268 5:160129162-160129184 TCCTCAAAAATTGACCCCACAGG No data
1000320264_1000320268 21 Left 1000320264 5:160129118-160129140 CCTTTTTCTTTGTATATTCCTAA No data
Right 1000320268 5:160129162-160129184 TCCTCAAAAATTGACCCCACAGG No data
1000320263_1000320268 22 Left 1000320263 5:160129117-160129139 CCCTTTTTCTTTGTATATTCCTA No data
Right 1000320268 5:160129162-160129184 TCCTCAAAAATTGACCCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000320268 Original CRISPR TCCTCAAAAATTGACCCCAC AGG Intergenic