ID: 1000320269

View in Genome Browser
Species Human (GRCh38)
Location 5:160129163-160129185
Sequence GCCTGTGGGGTCAATTTTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000320269_1000320281 15 Left 1000320269 5:160129163-160129185 CCTCAAAAATTGACCCCACAGGC No data
Right 1000320281 5:160129201-160129223 GTGGTTCTAGGTGAACCATTTGG No data
1000320269_1000320274 -9 Left 1000320269 5:160129163-160129185 CCTCAAAAATTGACCCCACAGGC No data
Right 1000320274 5:160129177-160129199 CCCACAGGCACCACTGTGGAGGG No data
1000320269_1000320272 -10 Left 1000320269 5:160129163-160129185 CCTCAAAAATTGACCCCACAGGC No data
Right 1000320272 5:160129176-160129198 CCCCACAGGCACCACTGTGGAGG No data
1000320269_1000320280 3 Left 1000320269 5:160129163-160129185 CCTCAAAAATTGACCCCACAGGC No data
Right 1000320280 5:160129189-160129211 ACTGTGGAGGGGGTGGTTCTAGG No data
1000320269_1000320278 -4 Left 1000320269 5:160129163-160129185 CCTCAAAAATTGACCCCACAGGC No data
Right 1000320278 5:160129182-160129204 AGGCACCACTGTGGAGGGGGTGG No data
1000320269_1000320276 -8 Left 1000320269 5:160129163-160129185 CCTCAAAAATTGACCCCACAGGC No data
Right 1000320276 5:160129178-160129200 CCACAGGCACCACTGTGGAGGGG No data
1000320269_1000320282 24 Left 1000320269 5:160129163-160129185 CCTCAAAAATTGACCCCACAGGC No data
Right 1000320282 5:160129210-160129232 GGTGAACCATTTGGTTTGCCTGG No data
1000320269_1000320277 -7 Left 1000320269 5:160129163-160129185 CCTCAAAAATTGACCCCACAGGC No data
Right 1000320277 5:160129179-160129201 CACAGGCACCACTGTGGAGGGGG No data
1000320269_1000320283 25 Left 1000320269 5:160129163-160129185 CCTCAAAAATTGACCCCACAGGC No data
Right 1000320283 5:160129211-160129233 GTGAACCATTTGGTTTGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000320269 Original CRISPR GCCTGTGGGGTCAATTTTTG AGG (reversed) Intergenic