ID: 1000320270

View in Genome Browser
Species Human (GRCh38)
Location 5:160129173-160129195
Sequence TGACCCCACAGGCACCACTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000320265_1000320270 14 Left 1000320265 5:160129136-160129158 CCTAACAATTCCCATGTCAACAT No data
Right 1000320270 5:160129173-160129195 TGACCCCACAGGCACCACTGTGG No data
1000320266_1000320270 4 Left 1000320266 5:160129146-160129168 CCCATGTCAACATAATTCCTCAA No data
Right 1000320270 5:160129173-160129195 TGACCCCACAGGCACCACTGTGG No data
1000320267_1000320270 3 Left 1000320267 5:160129147-160129169 CCATGTCAACATAATTCCTCAAA No data
Right 1000320270 5:160129173-160129195 TGACCCCACAGGCACCACTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000320270 Original CRISPR TGACCCCACAGGCACCACTG TGG Intergenic