ID: 1000320271

View in Genome Browser
Species Human (GRCh38)
Location 5:160129176-160129198
Sequence CCTCCACAGTGGTGCCTGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000320271_1000320286 20 Left 1000320271 5:160129176-160129198 CCCCACAGGCACCACTGTGGAGG No data
Right 1000320286 5:160129219-160129241 TTTGGTTTGCCTGGGACTGAGGG No data
1000320271_1000320282 11 Left 1000320271 5:160129176-160129198 CCCCACAGGCACCACTGTGGAGG No data
Right 1000320282 5:160129210-160129232 GGTGAACCATTTGGTTTGCCTGG No data
1000320271_1000320285 19 Left 1000320271 5:160129176-160129198 CCCCACAGGCACCACTGTGGAGG No data
Right 1000320285 5:160129218-160129240 ATTTGGTTTGCCTGGGACTGAGG No data
1000320271_1000320281 2 Left 1000320271 5:160129176-160129198 CCCCACAGGCACCACTGTGGAGG No data
Right 1000320281 5:160129201-160129223 GTGGTTCTAGGTGAACCATTTGG No data
1000320271_1000320280 -10 Left 1000320271 5:160129176-160129198 CCCCACAGGCACCACTGTGGAGG No data
Right 1000320280 5:160129189-160129211 ACTGTGGAGGGGGTGGTTCTAGG No data
1000320271_1000320289 29 Left 1000320271 5:160129176-160129198 CCCCACAGGCACCACTGTGGAGG No data
Right 1000320289 5:160129228-160129250 CCTGGGACTGAGGGGTTTCCTGG No data
1000320271_1000320283 12 Left 1000320271 5:160129176-160129198 CCCCACAGGCACCACTGTGGAGG No data
Right 1000320283 5:160129211-160129233 GTGAACCATTTGGTTTGCCTGGG No data
1000320271_1000320287 21 Left 1000320271 5:160129176-160129198 CCCCACAGGCACCACTGTGGAGG No data
Right 1000320287 5:160129220-160129242 TTGGTTTGCCTGGGACTGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000320271 Original CRISPR CCTCCACAGTGGTGCCTGTG GGG (reversed) Intergenic