ID: 1000320273

View in Genome Browser
Species Human (GRCh38)
Location 5:160129177-160129199
Sequence CCCTCCACAGTGGTGCCTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000320273_1000320289 28 Left 1000320273 5:160129177-160129199 CCCACAGGCACCACTGTGGAGGG No data
Right 1000320289 5:160129228-160129250 CCTGGGACTGAGGGGTTTCCTGG No data
1000320273_1000320287 20 Left 1000320273 5:160129177-160129199 CCCACAGGCACCACTGTGGAGGG No data
Right 1000320287 5:160129220-160129242 TTGGTTTGCCTGGGACTGAGGGG No data
1000320273_1000320282 10 Left 1000320273 5:160129177-160129199 CCCACAGGCACCACTGTGGAGGG No data
Right 1000320282 5:160129210-160129232 GGTGAACCATTTGGTTTGCCTGG No data
1000320273_1000320285 18 Left 1000320273 5:160129177-160129199 CCCACAGGCACCACTGTGGAGGG No data
Right 1000320285 5:160129218-160129240 ATTTGGTTTGCCTGGGACTGAGG No data
1000320273_1000320283 11 Left 1000320273 5:160129177-160129199 CCCACAGGCACCACTGTGGAGGG No data
Right 1000320283 5:160129211-160129233 GTGAACCATTTGGTTTGCCTGGG No data
1000320273_1000320286 19 Left 1000320273 5:160129177-160129199 CCCACAGGCACCACTGTGGAGGG No data
Right 1000320286 5:160129219-160129241 TTTGGTTTGCCTGGGACTGAGGG No data
1000320273_1000320281 1 Left 1000320273 5:160129177-160129199 CCCACAGGCACCACTGTGGAGGG No data
Right 1000320281 5:160129201-160129223 GTGGTTCTAGGTGAACCATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000320273 Original CRISPR CCCTCCACAGTGGTGCCTGT GGG (reversed) Intergenic