ID: 1000320277

View in Genome Browser
Species Human (GRCh38)
Location 5:160129179-160129201
Sequence CACAGGCACCACTGTGGAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000320269_1000320277 -7 Left 1000320269 5:160129163-160129185 CCTCAAAAATTGACCCCACAGGC No data
Right 1000320277 5:160129179-160129201 CACAGGCACCACTGTGGAGGGGG No data
1000320267_1000320277 9 Left 1000320267 5:160129147-160129169 CCATGTCAACATAATTCCTCAAA No data
Right 1000320277 5:160129179-160129201 CACAGGCACCACTGTGGAGGGGG No data
1000320265_1000320277 20 Left 1000320265 5:160129136-160129158 CCTAACAATTCCCATGTCAACAT No data
Right 1000320277 5:160129179-160129201 CACAGGCACCACTGTGGAGGGGG No data
1000320266_1000320277 10 Left 1000320266 5:160129146-160129168 CCCATGTCAACATAATTCCTCAA No data
Right 1000320277 5:160129179-160129201 CACAGGCACCACTGTGGAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000320277 Original CRISPR CACAGGCACCACTGTGGAGG GGG Intergenic
No off target data available for this crispr