ID: 1000320279

View in Genome Browser
Species Human (GRCh38)
Location 5:160129187-160129209
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 180}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000320279_1000320285 8 Left 1000320279 5:160129187-160129209 CCACTGTGGAGGGGGTGGTTCTA 0: 1
1: 0
2: 1
3: 17
4: 180
Right 1000320285 5:160129218-160129240 ATTTGGTTTGCCTGGGACTGAGG No data
1000320279_1000320282 0 Left 1000320279 5:160129187-160129209 CCACTGTGGAGGGGGTGGTTCTA 0: 1
1: 0
2: 1
3: 17
4: 180
Right 1000320282 5:160129210-160129232 GGTGAACCATTTGGTTTGCCTGG No data
1000320279_1000320289 18 Left 1000320279 5:160129187-160129209 CCACTGTGGAGGGGGTGGTTCTA 0: 1
1: 0
2: 1
3: 17
4: 180
Right 1000320289 5:160129228-160129250 CCTGGGACTGAGGGGTTTCCTGG No data
1000320279_1000320283 1 Left 1000320279 5:160129187-160129209 CCACTGTGGAGGGGGTGGTTCTA 0: 1
1: 0
2: 1
3: 17
4: 180
Right 1000320283 5:160129211-160129233 GTGAACCATTTGGTTTGCCTGGG No data
1000320279_1000320287 10 Left 1000320279 5:160129187-160129209 CCACTGTGGAGGGGGTGGTTCTA 0: 1
1: 0
2: 1
3: 17
4: 180
Right 1000320287 5:160129220-160129242 TTGGTTTGCCTGGGACTGAGGGG No data
1000320279_1000320281 -9 Left 1000320279 5:160129187-160129209 CCACTGTGGAGGGGGTGGTTCTA 0: 1
1: 0
2: 1
3: 17
4: 180
Right 1000320281 5:160129201-160129223 GTGGTTCTAGGTGAACCATTTGG No data
1000320279_1000320290 26 Left 1000320279 5:160129187-160129209 CCACTGTGGAGGGGGTGGTTCTA 0: 1
1: 0
2: 1
3: 17
4: 180
Right 1000320290 5:160129236-160129258 TGAGGGGTTTCCTGGCATGCAGG No data
1000320279_1000320286 9 Left 1000320279 5:160129187-160129209 CCACTGTGGAGGGGGTGGTTCTA 0: 1
1: 0
2: 1
3: 17
4: 180
Right 1000320286 5:160129219-160129241 TTTGGTTTGCCTGGGACTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000320279 Original CRISPR TAGAACCACCCCCTCCACAG TGG (reversed) Intergenic