ID: 1000320280

View in Genome Browser
Species Human (GRCh38)
Location 5:160129189-160129211
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000320266_1000320280 20 Left 1000320266 5:160129146-160129168 CCCATGTCAACATAATTCCTCAA No data
Right 1000320280 5:160129189-160129211 ACTGTGGAGGGGGTGGTTCTAGG No data
1000320269_1000320280 3 Left 1000320269 5:160129163-160129185 CCTCAAAAATTGACCCCACAGGC No data
Right 1000320280 5:160129189-160129211 ACTGTGGAGGGGGTGGTTCTAGG No data
1000320265_1000320280 30 Left 1000320265 5:160129136-160129158 CCTAACAATTCCCATGTCAACAT No data
Right 1000320280 5:160129189-160129211 ACTGTGGAGGGGGTGGTTCTAGG No data
1000320271_1000320280 -10 Left 1000320271 5:160129176-160129198 CCCCACAGGCACCACTGTGGAGG No data
Right 1000320280 5:160129189-160129211 ACTGTGGAGGGGGTGGTTCTAGG No data
1000320267_1000320280 19 Left 1000320267 5:160129147-160129169 CCATGTCAACATAATTCCTCAAA No data
Right 1000320280 5:160129189-160129211 ACTGTGGAGGGGGTGGTTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000320280 Original CRISPR ACTGTGGAGGGGGTGGTTCT AGG Intergenic