ID: 1000320285

View in Genome Browser
Species Human (GRCh38)
Location 5:160129218-160129240
Sequence ATTTGGTTTGCCTGGGACTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000320279_1000320285 8 Left 1000320279 5:160129187-160129209 CCACTGTGGAGGGGGTGGTTCTA No data
Right 1000320285 5:160129218-160129240 ATTTGGTTTGCCTGGGACTGAGG No data
1000320275_1000320285 17 Left 1000320275 5:160129178-160129200 CCACAGGCACCACTGTGGAGGGG No data
Right 1000320285 5:160129218-160129240 ATTTGGTTTGCCTGGGACTGAGG No data
1000320273_1000320285 18 Left 1000320273 5:160129177-160129199 CCCACAGGCACCACTGTGGAGGG No data
Right 1000320285 5:160129218-160129240 ATTTGGTTTGCCTGGGACTGAGG No data
1000320271_1000320285 19 Left 1000320271 5:160129176-160129198 CCCCACAGGCACCACTGTGGAGG No data
Right 1000320285 5:160129218-160129240 ATTTGGTTTGCCTGGGACTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000320285 Original CRISPR ATTTGGTTTGCCTGGGACTG AGG Intergenic