ID: 1000320286

View in Genome Browser
Species Human (GRCh38)
Location 5:160129219-160129241
Sequence TTTGGTTTGCCTGGGACTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000320279_1000320286 9 Left 1000320279 5:160129187-160129209 CCACTGTGGAGGGGGTGGTTCTA No data
Right 1000320286 5:160129219-160129241 TTTGGTTTGCCTGGGACTGAGGG No data
1000320271_1000320286 20 Left 1000320271 5:160129176-160129198 CCCCACAGGCACCACTGTGGAGG No data
Right 1000320286 5:160129219-160129241 TTTGGTTTGCCTGGGACTGAGGG No data
1000320273_1000320286 19 Left 1000320273 5:160129177-160129199 CCCACAGGCACCACTGTGGAGGG No data
Right 1000320286 5:160129219-160129241 TTTGGTTTGCCTGGGACTGAGGG No data
1000320275_1000320286 18 Left 1000320275 5:160129178-160129200 CCACAGGCACCACTGTGGAGGGG No data
Right 1000320286 5:160129219-160129241 TTTGGTTTGCCTGGGACTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000320286 Original CRISPR TTTGGTTTGCCTGGGACTGA GGG Intergenic