ID: 1000324262

View in Genome Browser
Species Human (GRCh38)
Location 5:160160193-160160215
Sequence TTTGCTCGCAGGGCTCCCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000324262_1000324270 14 Left 1000324262 5:160160193-160160215 CCTGCGGGAGCCCTGCGAGCAAA No data
Right 1000324270 5:160160230-160160252 GTCCTTTGTTTCAACAGGGCAGG No data
1000324262_1000324267 9 Left 1000324262 5:160160193-160160215 CCTGCGGGAGCCCTGCGAGCAAA No data
Right 1000324267 5:160160225-160160247 ATCCTGTCCTTTGTTTCAACAGG No data
1000324262_1000324268 10 Left 1000324262 5:160160193-160160215 CCTGCGGGAGCCCTGCGAGCAAA No data
Right 1000324268 5:160160226-160160248 TCCTGTCCTTTGTTTCAACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000324262 Original CRISPR TTTGCTCGCAGGGCTCCCGC AGG (reversed) Intergenic
No off target data available for this crispr