ID: 1000324263

View in Genome Browser
Species Human (GRCh38)
Location 5:160160203-160160225
Sequence TCTCAGGCGGTTTGCTCGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000324263_1000324270 4 Left 1000324263 5:160160203-160160225 CCCTGCGAGCAAACCGCCTGAGA No data
Right 1000324270 5:160160230-160160252 GTCCTTTGTTTCAACAGGGCAGG No data
1000324263_1000324272 21 Left 1000324263 5:160160203-160160225 CCCTGCGAGCAAACCGCCTGAGA No data
Right 1000324272 5:160160247-160160269 GGCAGGAATTTCCGAGCCTGAGG No data
1000324263_1000324267 -1 Left 1000324263 5:160160203-160160225 CCCTGCGAGCAAACCGCCTGAGA No data
Right 1000324267 5:160160225-160160247 ATCCTGTCCTTTGTTTCAACAGG No data
1000324263_1000324268 0 Left 1000324263 5:160160203-160160225 CCCTGCGAGCAAACCGCCTGAGA No data
Right 1000324268 5:160160226-160160248 TCCTGTCCTTTGTTTCAACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000324263 Original CRISPR TCTCAGGCGGTTTGCTCGCA GGG (reversed) Intergenic