ID: 1000324264

View in Genome Browser
Species Human (GRCh38)
Location 5:160160204-160160226
Sequence ATCTCAGGCGGTTTGCTCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000324264_1000324272 20 Left 1000324264 5:160160204-160160226 CCTGCGAGCAAACCGCCTGAGAT No data
Right 1000324272 5:160160247-160160269 GGCAGGAATTTCCGAGCCTGAGG No data
1000324264_1000324268 -1 Left 1000324264 5:160160204-160160226 CCTGCGAGCAAACCGCCTGAGAT No data
Right 1000324268 5:160160226-160160248 TCCTGTCCTTTGTTTCAACAGGG No data
1000324264_1000324267 -2 Left 1000324264 5:160160204-160160226 CCTGCGAGCAAACCGCCTGAGAT No data
Right 1000324267 5:160160225-160160247 ATCCTGTCCTTTGTTTCAACAGG No data
1000324264_1000324270 3 Left 1000324264 5:160160204-160160226 CCTGCGAGCAAACCGCCTGAGAT No data
Right 1000324270 5:160160230-160160252 GTCCTTTGTTTCAACAGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000324264 Original CRISPR ATCTCAGGCGGTTTGCTCGC AGG (reversed) Intergenic