ID: 1000324265

View in Genome Browser
Species Human (GRCh38)
Location 5:160160216-160160238
Sequence ACAAAGGACAGGATCTCAGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000324265_1000324274 21 Left 1000324265 5:160160216-160160238 CCGCCTGAGATCCTGTCCTTTGT No data
Right 1000324274 5:160160260-160160282 GAGCCTGAGGTATTTGCATTTGG No data
1000324265_1000324272 8 Left 1000324265 5:160160216-160160238 CCGCCTGAGATCCTGTCCTTTGT No data
Right 1000324272 5:160160247-160160269 GGCAGGAATTTCCGAGCCTGAGG No data
1000324265_1000324270 -9 Left 1000324265 5:160160216-160160238 CCGCCTGAGATCCTGTCCTTTGT No data
Right 1000324270 5:160160230-160160252 GTCCTTTGTTTCAACAGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000324265 Original CRISPR ACAAAGGACAGGATCTCAGG CGG (reversed) Intergenic