ID: 1000324267

View in Genome Browser
Species Human (GRCh38)
Location 5:160160225-160160247
Sequence ATCCTGTCCTTTGTTTCAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000324263_1000324267 -1 Left 1000324263 5:160160203-160160225 CCCTGCGAGCAAACCGCCTGAGA No data
Right 1000324267 5:160160225-160160247 ATCCTGTCCTTTGTTTCAACAGG No data
1000324261_1000324267 12 Left 1000324261 5:160160190-160160212 CCACCTGCGGGAGCCCTGCGAGC No data
Right 1000324267 5:160160225-160160247 ATCCTGTCCTTTGTTTCAACAGG No data
1000324262_1000324267 9 Left 1000324262 5:160160193-160160215 CCTGCGGGAGCCCTGCGAGCAAA No data
Right 1000324267 5:160160225-160160247 ATCCTGTCCTTTGTTTCAACAGG No data
1000324258_1000324267 27 Left 1000324258 5:160160175-160160197 CCTGGCTGGGACGGTCCACCTGC No data
Right 1000324267 5:160160225-160160247 ATCCTGTCCTTTGTTTCAACAGG No data
1000324264_1000324267 -2 Left 1000324264 5:160160204-160160226 CCTGCGAGCAAACCGCCTGAGAT No data
Right 1000324267 5:160160225-160160247 ATCCTGTCCTTTGTTTCAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000324267 Original CRISPR ATCCTGTCCTTTGTTTCAAC AGG Intergenic
No off target data available for this crispr