ID: 1000324268

View in Genome Browser
Species Human (GRCh38)
Location 5:160160226-160160248
Sequence TCCTGTCCTTTGTTTCAACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000324258_1000324268 28 Left 1000324258 5:160160175-160160197 CCTGGCTGGGACGGTCCACCTGC No data
Right 1000324268 5:160160226-160160248 TCCTGTCCTTTGTTTCAACAGGG No data
1000324263_1000324268 0 Left 1000324263 5:160160203-160160225 CCCTGCGAGCAAACCGCCTGAGA No data
Right 1000324268 5:160160226-160160248 TCCTGTCCTTTGTTTCAACAGGG No data
1000324262_1000324268 10 Left 1000324262 5:160160193-160160215 CCTGCGGGAGCCCTGCGAGCAAA No data
Right 1000324268 5:160160226-160160248 TCCTGTCCTTTGTTTCAACAGGG No data
1000324264_1000324268 -1 Left 1000324264 5:160160204-160160226 CCTGCGAGCAAACCGCCTGAGAT No data
Right 1000324268 5:160160226-160160248 TCCTGTCCTTTGTTTCAACAGGG No data
1000324261_1000324268 13 Left 1000324261 5:160160190-160160212 CCACCTGCGGGAGCCCTGCGAGC No data
Right 1000324268 5:160160226-160160248 TCCTGTCCTTTGTTTCAACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000324268 Original CRISPR TCCTGTCCTTTGTTTCAACA GGG Intergenic
No off target data available for this crispr