ID: 1000327290

View in Genome Browser
Species Human (GRCh38)
Location 5:160182023-160182045
Sequence TCCTGTTGGCTCCAATCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000327290_1000327303 27 Left 1000327290 5:160182023-160182045 CCAGCAGATTGGAGCCAACAGGA No data
Right 1000327303 5:160182073-160182095 AAGGCATTAGGTTACAGGGCGGG No data
1000327290_1000327293 2 Left 1000327290 5:160182023-160182045 CCAGCAGATTGGAGCCAACAGGA No data
Right 1000327293 5:160182048-160182070 TCCCCAAGTGCCTTTTAGTAGGG No data
1000327290_1000327301 23 Left 1000327290 5:160182023-160182045 CCAGCAGATTGGAGCCAACAGGA No data
Right 1000327301 5:160182069-160182091 GGTGAAGGCATTAGGTTACAGGG No data
1000327290_1000327300 22 Left 1000327290 5:160182023-160182045 CCAGCAGATTGGAGCCAACAGGA No data
Right 1000327300 5:160182068-160182090 GGGTGAAGGCATTAGGTTACAGG No data
1000327290_1000327297 8 Left 1000327290 5:160182023-160182045 CCAGCAGATTGGAGCCAACAGGA No data
Right 1000327297 5:160182054-160182076 AGTGCCTTTTAGTAGGGTGAAGG No data
1000327290_1000327302 26 Left 1000327290 5:160182023-160182045 CCAGCAGATTGGAGCCAACAGGA No data
Right 1000327302 5:160182072-160182094 GAAGGCATTAGGTTACAGGGCGG No data
1000327290_1000327299 15 Left 1000327290 5:160182023-160182045 CCAGCAGATTGGAGCCAACAGGA No data
Right 1000327299 5:160182061-160182083 TTTAGTAGGGTGAAGGCATTAGG No data
1000327290_1000327292 1 Left 1000327290 5:160182023-160182045 CCAGCAGATTGGAGCCAACAGGA No data
Right 1000327292 5:160182047-160182069 ATCCCCAAGTGCCTTTTAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000327290 Original CRISPR TCCTGTTGGCTCCAATCTGC TGG (reversed) Intergenic
No off target data available for this crispr