ID: 1000327291

View in Genome Browser
Species Human (GRCh38)
Location 5:160182037-160182059
Sequence GGCACTTGGGGATTTCCTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000327291_1000327304 20 Left 1000327291 5:160182037-160182059 CCAACAGGAAATCCCCAAGTGCC No data
Right 1000327304 5:160182080-160182102 TAGGTTACAGGGCGGGCAGATGG No data
1000327291_1000327301 9 Left 1000327291 5:160182037-160182059 CCAACAGGAAATCCCCAAGTGCC No data
Right 1000327301 5:160182069-160182091 GGTGAAGGCATTAGGTTACAGGG No data
1000327291_1000327303 13 Left 1000327291 5:160182037-160182059 CCAACAGGAAATCCCCAAGTGCC No data
Right 1000327303 5:160182073-160182095 AAGGCATTAGGTTACAGGGCGGG No data
1000327291_1000327297 -6 Left 1000327291 5:160182037-160182059 CCAACAGGAAATCCCCAAGTGCC No data
Right 1000327297 5:160182054-160182076 AGTGCCTTTTAGTAGGGTGAAGG No data
1000327291_1000327306 22 Left 1000327291 5:160182037-160182059 CCAACAGGAAATCCCCAAGTGCC No data
Right 1000327306 5:160182082-160182104 GGTTACAGGGCGGGCAGATGGGG No data
1000327291_1000327305 21 Left 1000327291 5:160182037-160182059 CCAACAGGAAATCCCCAAGTGCC No data
Right 1000327305 5:160182081-160182103 AGGTTACAGGGCGGGCAGATGGG No data
1000327291_1000327302 12 Left 1000327291 5:160182037-160182059 CCAACAGGAAATCCCCAAGTGCC No data
Right 1000327302 5:160182072-160182094 GAAGGCATTAGGTTACAGGGCGG No data
1000327291_1000327300 8 Left 1000327291 5:160182037-160182059 CCAACAGGAAATCCCCAAGTGCC No data
Right 1000327300 5:160182068-160182090 GGGTGAAGGCATTAGGTTACAGG No data
1000327291_1000327299 1 Left 1000327291 5:160182037-160182059 CCAACAGGAAATCCCCAAGTGCC No data
Right 1000327299 5:160182061-160182083 TTTAGTAGGGTGAAGGCATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000327291 Original CRISPR GGCACTTGGGGATTTCCTGT TGG (reversed) Intergenic