ID: 1000327292

View in Genome Browser
Species Human (GRCh38)
Location 5:160182047-160182069
Sequence ATCCCCAAGTGCCTTTTAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000327287_1000327292 26 Left 1000327287 5:160181998-160182020 CCTCTGACTTTCAAGATGTCAGA No data
Right 1000327292 5:160182047-160182069 ATCCCCAAGTGCCTTTTAGTAGG No data
1000327290_1000327292 1 Left 1000327290 5:160182023-160182045 CCAGCAGATTGGAGCCAACAGGA No data
Right 1000327292 5:160182047-160182069 ATCCCCAAGTGCCTTTTAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000327292 Original CRISPR ATCCCCAAGTGCCTTTTAGT AGG Intergenic