ID: 1000327293

View in Genome Browser
Species Human (GRCh38)
Location 5:160182048-160182070
Sequence TCCCCAAGTGCCTTTTAGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000327287_1000327293 27 Left 1000327287 5:160181998-160182020 CCTCTGACTTTCAAGATGTCAGA No data
Right 1000327293 5:160182048-160182070 TCCCCAAGTGCCTTTTAGTAGGG No data
1000327290_1000327293 2 Left 1000327290 5:160182023-160182045 CCAGCAGATTGGAGCCAACAGGA No data
Right 1000327293 5:160182048-160182070 TCCCCAAGTGCCTTTTAGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000327293 Original CRISPR TCCCCAAGTGCCTTTTAGTA GGG Intergenic