ID: 1000327294

View in Genome Browser
Species Human (GRCh38)
Location 5:160182049-160182071
Sequence ACCCTACTAAAAGGCACTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 93}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000327294_1000327300 -4 Left 1000327294 5:160182049-160182071 CCCCAAGTGCCTTTTAGTAGGGT 0: 1
1: 0
2: 1
3: 4
4: 93
Right 1000327300 5:160182068-160182090 GGGTGAAGGCATTAGGTTACAGG No data
1000327294_1000327305 9 Left 1000327294 5:160182049-160182071 CCCCAAGTGCCTTTTAGTAGGGT 0: 1
1: 0
2: 1
3: 4
4: 93
Right 1000327305 5:160182081-160182103 AGGTTACAGGGCGGGCAGATGGG No data
1000327294_1000327302 0 Left 1000327294 5:160182049-160182071 CCCCAAGTGCCTTTTAGTAGGGT 0: 1
1: 0
2: 1
3: 4
4: 93
Right 1000327302 5:160182072-160182094 GAAGGCATTAGGTTACAGGGCGG No data
1000327294_1000327301 -3 Left 1000327294 5:160182049-160182071 CCCCAAGTGCCTTTTAGTAGGGT 0: 1
1: 0
2: 1
3: 4
4: 93
Right 1000327301 5:160182069-160182091 GGTGAAGGCATTAGGTTACAGGG No data
1000327294_1000327306 10 Left 1000327294 5:160182049-160182071 CCCCAAGTGCCTTTTAGTAGGGT 0: 1
1: 0
2: 1
3: 4
4: 93
Right 1000327306 5:160182082-160182104 GGTTACAGGGCGGGCAGATGGGG No data
1000327294_1000327303 1 Left 1000327294 5:160182049-160182071 CCCCAAGTGCCTTTTAGTAGGGT 0: 1
1: 0
2: 1
3: 4
4: 93
Right 1000327303 5:160182073-160182095 AAGGCATTAGGTTACAGGGCGGG No data
1000327294_1000327304 8 Left 1000327294 5:160182049-160182071 CCCCAAGTGCCTTTTAGTAGGGT 0: 1
1: 0
2: 1
3: 4
4: 93
Right 1000327304 5:160182080-160182102 TAGGTTACAGGGCGGGCAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000327294 Original CRISPR ACCCTACTAAAAGGCACTTG GGG (reversed) Intergenic