ID: 1000327296

View in Genome Browser
Species Human (GRCh38)
Location 5:160182051-160182073
Sequence TCACCCTACTAAAAGGCACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000327296_1000327304 6 Left 1000327296 5:160182051-160182073 CCAAGTGCCTTTTAGTAGGGTGA No data
Right 1000327304 5:160182080-160182102 TAGGTTACAGGGCGGGCAGATGG No data
1000327296_1000327302 -2 Left 1000327296 5:160182051-160182073 CCAAGTGCCTTTTAGTAGGGTGA No data
Right 1000327302 5:160182072-160182094 GAAGGCATTAGGTTACAGGGCGG No data
1000327296_1000327306 8 Left 1000327296 5:160182051-160182073 CCAAGTGCCTTTTAGTAGGGTGA No data
Right 1000327306 5:160182082-160182104 GGTTACAGGGCGGGCAGATGGGG No data
1000327296_1000327303 -1 Left 1000327296 5:160182051-160182073 CCAAGTGCCTTTTAGTAGGGTGA No data
Right 1000327303 5:160182073-160182095 AAGGCATTAGGTTACAGGGCGGG No data
1000327296_1000327300 -6 Left 1000327296 5:160182051-160182073 CCAAGTGCCTTTTAGTAGGGTGA No data
Right 1000327300 5:160182068-160182090 GGGTGAAGGCATTAGGTTACAGG No data
1000327296_1000327305 7 Left 1000327296 5:160182051-160182073 CCAAGTGCCTTTTAGTAGGGTGA No data
Right 1000327305 5:160182081-160182103 AGGTTACAGGGCGGGCAGATGGG No data
1000327296_1000327301 -5 Left 1000327296 5:160182051-160182073 CCAAGTGCCTTTTAGTAGGGTGA No data
Right 1000327301 5:160182069-160182091 GGTGAAGGCATTAGGTTACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000327296 Original CRISPR TCACCCTACTAAAAGGCACT TGG (reversed) Intergenic