ID: 1000327297

View in Genome Browser
Species Human (GRCh38)
Location 5:160182054-160182076
Sequence AGTGCCTTTTAGTAGGGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000327290_1000327297 8 Left 1000327290 5:160182023-160182045 CCAGCAGATTGGAGCCAACAGGA No data
Right 1000327297 5:160182054-160182076 AGTGCCTTTTAGTAGGGTGAAGG No data
1000327291_1000327297 -6 Left 1000327291 5:160182037-160182059 CCAACAGGAAATCCCCAAGTGCC No data
Right 1000327297 5:160182054-160182076 AGTGCCTTTTAGTAGGGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000327297 Original CRISPR AGTGCCTTTTAGTAGGGTGA AGG Intergenic