ID: 1000327300

View in Genome Browser
Species Human (GRCh38)
Location 5:160182068-160182090
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000327291_1000327300 8 Left 1000327291 5:160182037-160182059 CCAACAGGAAATCCCCAAGTGCC No data
Right 1000327300 5:160182068-160182090 GGGTGAAGGCATTAGGTTACAGG No data
1000327294_1000327300 -4 Left 1000327294 5:160182049-160182071 CCCCAAGTGCCTTTTAGTAGGGT No data
Right 1000327300 5:160182068-160182090 GGGTGAAGGCATTAGGTTACAGG No data
1000327295_1000327300 -5 Left 1000327295 5:160182050-160182072 CCCAAGTGCCTTTTAGTAGGGTG No data
Right 1000327300 5:160182068-160182090 GGGTGAAGGCATTAGGTTACAGG No data
1000327296_1000327300 -6 Left 1000327296 5:160182051-160182073 CCAAGTGCCTTTTAGTAGGGTGA No data
Right 1000327300 5:160182068-160182090 GGGTGAAGGCATTAGGTTACAGG No data
1000327290_1000327300 22 Left 1000327290 5:160182023-160182045 CCAGCAGATTGGAGCCAACAGGA No data
Right 1000327300 5:160182068-160182090 GGGTGAAGGCATTAGGTTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000327300 Original CRISPR GGGTGAAGGCATTAGGTTAC AGG Intergenic