ID: 1000327303

View in Genome Browser
Species Human (GRCh38)
Location 5:160182073-160182095
Sequence AAGGCATTAGGTTACAGGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000327291_1000327303 13 Left 1000327291 5:160182037-160182059 CCAACAGGAAATCCCCAAGTGCC No data
Right 1000327303 5:160182073-160182095 AAGGCATTAGGTTACAGGGCGGG No data
1000327296_1000327303 -1 Left 1000327296 5:160182051-160182073 CCAAGTGCCTTTTAGTAGGGTGA No data
Right 1000327303 5:160182073-160182095 AAGGCATTAGGTTACAGGGCGGG No data
1000327294_1000327303 1 Left 1000327294 5:160182049-160182071 CCCCAAGTGCCTTTTAGTAGGGT No data
Right 1000327303 5:160182073-160182095 AAGGCATTAGGTTACAGGGCGGG No data
1000327295_1000327303 0 Left 1000327295 5:160182050-160182072 CCCAAGTGCCTTTTAGTAGGGTG No data
Right 1000327303 5:160182073-160182095 AAGGCATTAGGTTACAGGGCGGG No data
1000327290_1000327303 27 Left 1000327290 5:160182023-160182045 CCAGCAGATTGGAGCCAACAGGA No data
Right 1000327303 5:160182073-160182095 AAGGCATTAGGTTACAGGGCGGG No data
1000327298_1000327303 -8 Left 1000327298 5:160182058-160182080 CCTTTTAGTAGGGTGAAGGCATT No data
Right 1000327303 5:160182073-160182095 AAGGCATTAGGTTACAGGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000327303 Original CRISPR AAGGCATTAGGTTACAGGGC GGG Intergenic