ID: 1000327304

View in Genome Browser
Species Human (GRCh38)
Location 5:160182080-160182102
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000327296_1000327304 6 Left 1000327296 5:160182051-160182073 CCAAGTGCCTTTTAGTAGGGTGA No data
Right 1000327304 5:160182080-160182102 TAGGTTACAGGGCGGGCAGATGG No data
1000327298_1000327304 -1 Left 1000327298 5:160182058-160182080 CCTTTTAGTAGGGTGAAGGCATT No data
Right 1000327304 5:160182080-160182102 TAGGTTACAGGGCGGGCAGATGG No data
1000327294_1000327304 8 Left 1000327294 5:160182049-160182071 CCCCAAGTGCCTTTTAGTAGGGT No data
Right 1000327304 5:160182080-160182102 TAGGTTACAGGGCGGGCAGATGG No data
1000327291_1000327304 20 Left 1000327291 5:160182037-160182059 CCAACAGGAAATCCCCAAGTGCC No data
Right 1000327304 5:160182080-160182102 TAGGTTACAGGGCGGGCAGATGG No data
1000327295_1000327304 7 Left 1000327295 5:160182050-160182072 CCCAAGTGCCTTTTAGTAGGGTG No data
Right 1000327304 5:160182080-160182102 TAGGTTACAGGGCGGGCAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000327304 Original CRISPR TAGGTTACAGGGCGGGCAGA TGG Intergenic