ID: 1000334035

View in Genome Browser
Species Human (GRCh38)
Location 5:160228766-160228788
Sequence CTGGAGCAAAGCAAACTTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 240
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 218}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000334035_1000334037 5 Left 1000334035 5:160228766-160228788 CCTTCAAGTTTGCTTTGCTCCAG 0: 1
1: 0
2: 1
3: 20
4: 218
Right 1000334037 5:160228794-160228816 CTCATTGTTTCCTTTCATCATGG 0: 1
1: 0
2: 2
3: 33
4: 340

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000334035 Original CRISPR CTGGAGCAAAGCAAACTTGA AGG (reversed) Intronic
902573860 1:17364403-17364425 CTGTAGAAAATAAAACTTGATGG + Intergenic
905417965 1:37817758-37817780 CTTGAGAAAAGCAACCTTGGAGG - Intronic
907241977 1:53085926-53085948 CTGGAGCAGAGCCGACTTGGGGG + Intergenic
907635844 1:56134102-56134124 CTGAAGCAAAGCAAACCTTCCGG + Intergenic
907909516 1:58814429-58814451 CTGGAGCAAAGGAAACTAACTGG - Intergenic
910283774 1:85530549-85530571 AAGGACCAAAGCAAACATGAAGG + Intronic
910946655 1:92599990-92600012 CTGGAGAAAAGGAAACTGGATGG + Intronic
911758598 1:101589830-101589852 TTGCAGCACAGAAAACTTGATGG - Intergenic
912962723 1:114210228-114210250 CTGGAGCCAAGCAGACGTTAGGG - Intergenic
914206245 1:145532441-145532463 AAGGACCAAAGCAAACATGAAGG - Intergenic
918173868 1:182025934-182025956 TTGGAGCCAAGCAAACCTGGGGG + Intergenic
924022134 1:239795314-239795336 CTTGAGAAAAACAAACTTTAAGG - Intronic
924400839 1:243679302-243679324 CTTGAGCAATGCAAAGTTTAGGG - Intronic
1064796549 10:19018497-19018519 CTGGAGCAAAACAAGCTGAAAGG - Intergenic
1065312926 10:24433696-24433718 ATGGAGGAAAGAACACTTGAGGG - Intronic
1066401516 10:35081140-35081162 CTTGAGCAAAGGAGACTTCAAGG + Intronic
1067159044 10:43807425-43807447 CTGTAGCAAAGCAAGCAGGAGGG + Intergenic
1069778458 10:70940442-70940464 CTGGAGCACAGCAGCCTTCAAGG - Intergenic
1070985170 10:80683075-80683097 ATGGAGCAAAAGAAAGTTGAGGG - Intergenic
1072036208 10:91565293-91565315 CTGGAGCTGAGCAAACTCGCTGG + Intergenic
1073939604 10:108680439-108680461 CTGGAGAAAAGTGAACTGGAGGG - Intergenic
1075172804 10:120131630-120131652 CTGGAGCCAAGCAGACTTGAAGG - Intergenic
1075486243 10:122823799-122823821 CCGGATCAAATCATACTTGATGG - Intergenic
1076248037 10:128962527-128962549 CTGGAGTAAAGCCAAAATGAGGG + Intergenic
1076498585 10:130916205-130916227 CTGGAGCAGAGGAAACTAGAAGG + Intergenic
1077142584 11:1031019-1031041 CTGGAGGGCAGCAAACTTGTGGG + Exonic
1078448764 11:11424819-11424841 CTGGAGCTAAGCAAAGTGGGTGG + Intronic
1081195326 11:40153144-40153166 CTGGAGCCGAGCAGACTTGCTGG + Intronic
1082870643 11:57941718-57941740 CTGGAGCAAATCCATCTTTATGG + Intergenic
1084351363 11:68602295-68602317 CTTGAGCAAAGCAAACTCCAAGG - Intronic
1086801202 11:91178102-91178124 ATGGAGCAAACCCAAATTGAAGG - Intergenic
1088104138 11:106186575-106186597 CTGAAACAAACAAAACTTGATGG + Intergenic
1088924389 11:114285541-114285563 CGGGAGCACATCAAATTTGATGG + Intronic
1089976610 11:122737682-122737704 CTGGAGAGAAGCAAAATTGGCGG + Intronic
1090079807 11:123604487-123604509 CTGGCACAAAGCATGCTTGAGGG + Intronic
1090629321 11:128632684-128632706 CTGGAGCAATGCAGACAAGAGGG + Intergenic
1092479924 12:8850683-8850705 CTTAAGCAAAGAAAGCTTGATGG + Intronic
1092799377 12:12148839-12148861 CTGGAGCACAGGACACTTAAAGG + Intronic
1092994699 12:13938667-13938689 CTAGAGCAAAGCTAATTTGTGGG + Intronic
1093624642 12:21330538-21330560 CAGGAGCCAAACAAAGTTGAAGG + Intronic
1093697336 12:22176351-22176373 CAGGAGCAAAGCAAACTGAAAGG + Intronic
1095732762 12:45522815-45522837 CTGGAGCCAAGTAGACTTGCTGG + Intergenic
1097002065 12:55885157-55885179 CTGGATCAAAGCAAAGGTGTCGG - Intergenic
1100728482 12:97436341-97436363 CTGGATCAAACCATACCTGAAGG - Intergenic
1103561220 12:121794107-121794129 CTGGGGCAGTGCAAAGTTGAGGG - Exonic
1103748072 12:123139902-123139924 CTGGATGAAAGAAAACTTGGGGG - Intronic
1103925246 12:124420305-124420327 CTGGCCCAGAGCAAACATGATGG + Intronic
1105268937 13:18852296-18852318 GAGGAGCAAATCAAACCTGAGGG + Intergenic
1107626684 13:42293792-42293814 ATTCAGTAAAGCAAACTTGAAGG + Intronic
1108131819 13:47310021-47310043 CTGGAGCTGAGACAACTTGAGGG + Intergenic
1108824610 13:54397576-54397598 ATGGCGAAAACCAAACTTGATGG + Intergenic
1111897355 13:94157749-94157771 CTGGAGGAATGAAAACTGGAAGG + Intronic
1112928249 13:104703984-104704006 CTGGACTAAAGCAAGGTTGAAGG + Intergenic
1113218215 13:108068419-108068441 CTGGAGCAAACACAACTTGTGGG + Intergenic
1115402526 14:32978465-32978487 CTTGAGCACAGCAAGCTGGAAGG + Intronic
1115730999 14:36269890-36269912 CTGGAGAAAAACAATCTTGCAGG - Intergenic
1117808744 14:59522614-59522636 CTGGAGAAAAACAACTTTGAAGG - Intronic
1117814396 14:59582178-59582200 GAGGAGGAAAGCGAACTTGAAGG - Intergenic
1118694018 14:68366536-68366558 CTGGACTAAAGCAGCCTTGAAGG + Intronic
1119332128 14:73802701-73802723 CTGGAGCAAGTCAAAGGTGAGGG + Intergenic
1120809233 14:88786013-88786035 CTGGAGCAGAGTGAACTTGAAGG - Intronic
1120884429 14:89440931-89440953 CTGTAGCAAGGCAGACATGATGG + Intronic
1121745090 14:96282479-96282501 CTGAAGCAAAGCAAAGCAGAGGG + Exonic
1124887602 15:33701625-33701647 GTGGAGCAGAGCAACCTGGAGGG + Intronic
1124920774 15:34024196-34024218 CTGGTGGAATGCAAACTTCATGG - Intronic
1127002012 15:54520034-54520056 CTGGTGGAAAGCCAGCTTGAAGG + Intronic
1127614970 15:60675297-60675319 CCAAAGCAAAGCAATCTTGAAGG + Intronic
1127836936 15:62797663-62797685 CTGGAGCACGGCATACCTGAGGG + Intronic
1128280500 15:66390040-66390062 TTGGACCAAAGGAAACTGGAAGG + Intronic
1128691019 15:69725021-69725043 CTGGAGCTCAGAAAAGTTGATGG + Intergenic
1130099892 15:80885281-80885303 TTGGAGCAAAGCAATTTTGCTGG + Intronic
1130368197 15:83259711-83259733 CTGGAACAAAGCAAACCTCTGGG + Intronic
1130719305 15:86371304-86371326 CTGGAGCAAAGTCAGTTTGAAGG + Intronic
1131812666 15:96188781-96188803 CTGAAGCAAAGGAGACTGGAAGG - Intergenic
1135058083 16:19247380-19247402 CTGGATCAAAGCATACATGTTGG + Intronic
1135293748 16:21261940-21261962 CTGGAGCAGACCAAACTGGAAGG + Intronic
1135433593 16:22408791-22408813 CTGGAGCAAAGTAAGCAGGAGGG + Intronic
1137384735 16:48030831-48030853 CTGCACCAAAGCAATCTTGCTGG + Intergenic
1140208953 16:72955856-72955878 TTGGAGCAAATCAAACATAACGG - Intronic
1142675031 17:1508319-1508341 CTGGGGCACAGAAAACCTGAGGG + Intronic
1142998284 17:3774248-3774270 CAGGAGCAAAGCAATCTGGTGGG + Intronic
1143265308 17:5632447-5632469 CTGTAGCAAAGCAGATTGGAAGG + Intergenic
1143908456 17:10228076-10228098 GTGGAGCAAGGTAAAGTTGAAGG - Intergenic
1149373997 17:56025339-56025361 CTGCAGCAAAACCAATTTGAAGG - Intergenic
1153764121 18:8359241-8359263 CAGGATCAAAGCAAATTTGCAGG + Intronic
1153985069 18:10344105-10344127 CTGTGGCAAAGCAAATTTGAAGG + Intergenic
1154171159 18:12051508-12051530 CTAGAGCAAAGAAAACTCGTGGG - Intergenic
1155216767 18:23650031-23650053 CTGAAGCAAAGAAAATTAGATGG - Intronic
1155415296 18:25592341-25592363 CTGGTGAAAAGCAAGCTTGCAGG - Intergenic
1155815315 18:30300559-30300581 CTAGAACAATGCAACCTTGAAGG + Intergenic
1156249180 18:35334852-35334874 CTGGACCAAAAAAAACTGGATGG - Exonic
1157280588 18:46344370-46344392 CTGGAGCTAAGCAAGCTAGCTGG - Intronic
1159096881 18:63912616-63912638 CAGGAACAAAGCCTACTTGATGG + Intronic
1159455189 18:68652602-68652624 CTGAAGCAAAGCACACTGGAAGG - Intergenic
1159672690 18:71241514-71241536 ATGGAGCAAAGCAGCCTTCAGGG - Intergenic
925750067 2:7080970-7080992 CTTGAAAAAAGCAAAGTTGAAGG + Intergenic
926363060 2:12108158-12108180 ATGGAGCAAAGGAAACTATAAGG - Intergenic
927262385 2:21104990-21105012 CTGGAAGGAAGAAAACTTGAAGG - Intergenic
927765017 2:25798816-25798838 CTGGAGCACAGAAGATTTGAGGG + Intronic
930994689 2:57702221-57702243 CTGGAGGAAAGCACGCTTGAGGG + Intergenic
932809390 2:74811554-74811576 TTTGAACCAAGCAAACTTGATGG - Intergenic
933096590 2:78190801-78190823 CTGGAGCCATGCTAACTTGGAGG - Intergenic
934498161 2:94829530-94829552 GAGGAGCAAATCAAACCTGAGGG + Intergenic
938901215 2:135799890-135799912 CTGGAGCAAATCAAATTAGATGG + Intronic
938901390 2:135801238-135801260 CTGGAGCAAATCAAATCAGATGG + Intronic
941034288 2:160550732-160550754 TTGGAGGAAAGCAACCTAGAGGG + Intergenic
942133000 2:172898922-172898944 CTGCAGGAAAGAAAACCTGAGGG - Intronic
943703611 2:191012771-191012793 CTGGAGCAAAGCAGAAATGTTGG - Intronic
944385108 2:199155120-199155142 CTGGAGCCAAGGAAGCTGGATGG + Intergenic
944980705 2:205116689-205116711 CTGGATGAAATCAAACTGGAGGG + Intronic
947177092 2:227378741-227378763 ATGGAGCAATGGAAAGTTGAAGG + Intronic
948145104 2:235702876-235702898 ATGGAGTAAAACAAACTAGAAGG - Intronic
948442307 2:238001985-238002007 CTGAAACAAACCAAACATGATGG - Intronic
1170467011 20:16631244-16631266 CTGGAGGACAGCAAGCTTGGGGG + Intergenic
1171152899 20:22843342-22843364 GTGGAGGAAAGCAAAATTGGAGG + Intergenic
1171298343 20:24038250-24038272 CTGGAGCATAGCTAAGCTGATGG + Intergenic
1173384392 20:42574535-42574557 CTGGAGCAATGGTAACTTGCAGG - Intronic
1174698979 20:52588815-52588837 CTGGATCAAGGAAAACATGAGGG + Intergenic
1179454810 21:41491783-41491805 GTCCAGCAAAGTAAACTTGAGGG - Intronic
1182422837 22:30256915-30256937 CTGGGGAAAAGAGAACTTGAGGG + Intergenic
1184843959 22:47069785-47069807 TTGGAGCAGAGCTGACTTGACGG + Intronic
1185209464 22:49561552-49561574 CTGGAGCACAGCAAGCCAGAGGG + Intronic
950906496 3:16543788-16543810 CTGGAGTAAGGCAAACTGGATGG - Intergenic
951508497 3:23475860-23475882 TTAGATCAAAGCAATCTTGATGG - Intronic
951576469 3:24119836-24119858 ATTGAGCAAAGTACACTTGAGGG + Exonic
952037357 3:29218910-29218932 CTGAAGCATGGAAAACTTGAAGG + Intergenic
952191941 3:31032600-31032622 CTGAAGAAGAACAAACTTGACGG - Intergenic
952670666 3:35963564-35963586 AAGGAGTAAAGCAAAATTGAAGG + Intergenic
953251881 3:41251627-41251649 AAAGAGCAAAGCAATCTTGAGGG - Intronic
954455670 3:50598457-50598479 CTGGAGCACTGCAAACATCAAGG + Intergenic
954843260 3:53531820-53531842 CTTGAGCAAATCAATCTTGCTGG + Intronic
955640832 3:61082051-61082073 TTGGAGCAATGCAAAAATGAGGG - Intronic
959279839 3:104323833-104323855 CTGGAGCCAGGCAGACTTGCTGG + Intergenic
959631811 3:108515257-108515279 ATGGAGTGATGCAAACTTGAGGG + Intronic
960311427 3:116120830-116120852 CCTGAGTAAAACAAACTTGATGG + Intronic
963059496 3:141213536-141213558 CAGGTGGAAAGCAACCTTGAGGG - Intergenic
963421717 3:145069418-145069440 TTGGATCAAAGCACATTTGAAGG - Intergenic
965564889 3:170104571-170104593 TTGGAGCAAAGGAATTTTGAAGG - Intronic
965698663 3:171437315-171437337 CTGGAACAGAGCAAAGTGGAAGG - Intronic
967543718 3:190698849-190698871 CTGGAGGAAAGCATACTGAAAGG + Intergenic
967928109 3:194668549-194668571 CTAGAGTAAACCAGACTTGATGG - Intronic
973042341 4:45485892-45485914 CACCAGCAAAGCAGACTTGAAGG - Intergenic
973978068 4:56283046-56283068 CTGGAGCTCAGCACACTTGAAGG - Intronic
976351893 4:84069394-84069416 CATCAGCAAAGAAAACTTGATGG - Intergenic
976457860 4:85270034-85270056 CTGGAGGCAAGAAAACTGGATGG - Intergenic
977217534 4:94299444-94299466 CCCGAGAAAAACAAACTTGAAGG + Exonic
979402547 4:120266163-120266185 CTGGAGCAAGGGAAACAAGAGGG - Intergenic
980009465 4:127579759-127579781 CTGGAGCAAAGCACCCATGCTGG - Intergenic
980140452 4:128909798-128909820 CTGGAGCATAAAGAACTTGAAGG + Intronic
982201165 4:152961901-152961923 ATTGAGCAATGCAAACTTGTGGG + Intronic
982908415 4:161107965-161107987 ATGGAGCAAAGCAAATTCAATGG + Intergenic
983381490 4:167000395-167000417 CTTGAGCAATGCATACTTTATGG + Exonic
985774564 5:1834028-1834050 TTGGAGAAAGGCGAACTTGATGG - Intergenic
986216604 5:5725401-5725423 CAGGATAAAAGCAAGCTTGAAGG + Intergenic
986795128 5:11202747-11202769 CTGGAGAAAAGCAAAATAGAGGG - Intronic
987397835 5:17442460-17442482 CTGGGGCAAAGCAAACTTATTGG + Intergenic
987399846 5:17463837-17463859 CTGGAGCCAAGGAGACTGGACGG - Intergenic
988732189 5:33983668-33983690 CTGGACAAAAGCAAACCTGAGGG - Intronic
989348223 5:40453749-40453771 CTGGAGCCAAGGAGACTGGATGG - Intergenic
989479820 5:41917676-41917698 CTGAAGCATGGCAAACTTCAAGG - Exonic
990739964 5:58902497-58902519 CTGGAGCAAATTAAAACTGAAGG + Intergenic
991474124 5:67001785-67001807 TTTGAGCAGAGAAAACTTGAAGG - Intronic
991582541 5:68171895-68171917 ATGGAGCAAAGAAAAGTTGTAGG + Intergenic
991622057 5:68555288-68555310 CAGGAGCAAAGCAGAATTGTGGG + Intergenic
992414188 5:76537045-76537067 CTGTACCAAAGCTATCTTGAGGG + Intronic
992503894 5:77366885-77366907 CTGGACCAAAGCGCCCTTGATGG - Intronic
995676444 5:114667934-114667956 CAGGAGCAAAGTTAACCTGAAGG + Intergenic
996282596 5:121748929-121748951 GTGAAGCAAAGCAGACCTGAAGG - Intergenic
998546322 5:143031031-143031053 CTTGAGGAAAGGACACTTGAGGG + Intronic
1000334035 5:160228766-160228788 CTGGAGCAAAGCAAACTTGAAGG - Intronic
1002480753 5:179499204-179499226 CTGTAGCAAAGCAAAAAGGAGGG - Intergenic
1002971646 6:2028916-2028938 TGGGAGCAAAGCATACTTTAGGG + Intronic
1003270869 6:4606779-4606801 CTGGAGGAAAGCAAAGTCAATGG - Intergenic
1004223062 6:13763089-13763111 CTTGATCAAGGAAAACTTGAGGG - Intergenic
1005741482 6:28794973-28794995 CAGAAGCCAAGCAAACTTGTGGG - Intergenic
1005802273 6:29439529-29439551 CTGGAAAAAAGAAAACTAGAGGG + Exonic
1007521571 6:42454290-42454312 CTTGAACAAAGAAAGCTTGACGG - Intergenic
1011739069 6:90341420-90341442 TTGGTGCAAAGCAAACATAATGG - Intergenic
1011907767 6:92393134-92393156 CTGGAGCAAGGCACAGTTAAAGG + Intergenic
1012962363 6:105635624-105635646 AAGGAGCAAAGGAAACTGGAAGG - Intergenic
1014788761 6:125647220-125647242 CTGAAGAAAAGCAAAATAGATGG - Intergenic
1015590273 6:134816400-134816422 CTGCAGCAAATCAGAGTTGAGGG + Intergenic
1017440915 6:154463533-154463555 CGCGAGCATAGCAAACTTGTGGG - Intronic
1018949405 6:168369331-168369353 CTGGAGCAGAGCCCACGTGACGG + Intergenic
1020482013 7:8672974-8672996 CTTGACTAAAGCAATCTTGATGG - Intronic
1024596247 7:50940239-50940261 CTGCAGCAAATCTAAATTGATGG - Intergenic
1025035039 7:55588645-55588667 CTGGATCACAGCAACCTTGAAGG + Intergenic
1028648220 7:93121273-93121295 CTGGAGCAAACACAACCTGAAGG + Intergenic
1030753992 7:113266904-113266926 TTGGAGGAAAGCAAACTTGCTGG + Intergenic
1031388320 7:121180648-121180670 GTGTAGCAAAGAAAAATTGATGG - Intronic
1034026443 7:147709226-147709248 CTGGAGTAAAGATAACCTGATGG - Intronic
1035613127 8:982026-982048 CAGGAGCAAAGCAAGTTTAAAGG - Intergenic
1036178507 8:6562954-6562976 CAGCAGCTTAGCAAACTTGAGGG + Exonic
1036663665 8:10725490-10725512 CTGGAGGAAAACTCACTTGAAGG + Exonic
1038552469 8:28481879-28481901 CTGCAGTAAGGCAACCTTGAGGG + Intronic
1038811282 8:30848247-30848269 ATGAAGAAAAGCAAACTTCATGG - Exonic
1043124347 8:76370807-76370829 ATGAAACAAAGAAAACTTGAAGG - Intergenic
1043796579 8:84549384-84549406 GTGGATCAAAACAGACTTGAGGG + Intronic
1045251654 8:100487729-100487751 CTGGAGCAAAGCCGAGGTGATGG + Intergenic
1050115881 9:2263002-2263024 CTGGAAGAAAGCAAGGTTGATGG - Intergenic
1051859552 9:21608815-21608837 CCAGGGCAAAGCAAGCTTGATGG + Intergenic
1052254433 9:26437576-26437598 CTGCAGTAAAGCAACCTTGGTGG + Intergenic
1053054289 9:34985072-34985094 CTGGAGAGAAGCAGATTTGAAGG + Intergenic
1053658993 9:40250903-40250925 GAGGAGCAAATCAAACCTGAGGG - Intronic
1053909365 9:42880276-42880298 GAGGAGCAAATCAAACCTGAGGG - Intergenic
1054371116 9:64397203-64397225 GAGGAGCAAATCAAACCTGAGGG - Intronic
1054525605 9:66125319-66125341 GAGGAGCAAATCAAACCTGAGGG + Intronic
1054678744 9:67886922-67886944 GAGGAGCAAATCAAACCTGAGGG - Intronic
1055179863 9:73372510-73372532 CTGTAGCATAACAAAATTGAAGG - Intergenic
1056061964 9:82892773-82892795 CAGGAATAAAGCAAAGTTGAGGG + Intergenic
1056069615 9:82972673-82972695 AAGGAGCAATGCAAACTTGAAGG - Intergenic
1056549770 9:87642585-87642607 CTGGAACAAATCACACTTCAGGG + Intronic
1058412001 9:104743793-104743815 GGTGAGCAAAGGAAACTTGATGG - Intergenic
1058525046 9:105849423-105849445 CTGGAGGAAAGTGAACTAGAAGG + Intergenic
1059035266 9:110747811-110747833 CTGGAACAACGCAAATGTGAAGG - Intronic
1059067380 9:111099648-111099670 CTGGGGCAAAGGAAAGTTTATGG - Intergenic
1186134781 X:6507623-6507645 CTGGAGGAAAGAAAAAGTGAGGG - Intergenic
1186262631 X:7796016-7796038 TTGGAGTAAAGCAAGCTTTATGG + Intergenic
1186481627 X:9900792-9900814 CTGGAGGGAAGCAAACGTGCTGG - Intronic
1187760306 X:22576560-22576582 CTTGAGTAAAATAAACTTGATGG + Intergenic
1189029234 X:37432931-37432953 CTGGAGATCAGCAAACATGATGG - Intronic
1189422239 X:40866477-40866499 ATGGAGCATAGCAAATTTGAAGG - Intergenic
1189575694 X:42350778-42350800 GTGGAGAAAAGCAAAGTGGAGGG + Intergenic
1189907535 X:45777067-45777089 CAGCAGCAAAGACAACTTGAAGG + Intergenic
1190568543 X:51757899-51757921 CTAGAGAAAAGAAAACTTGCTGG - Intergenic
1190733122 X:53237502-53237524 CTGGAGAAGAGAAAACTTGGAGG + Intronic
1192362783 X:70449866-70449888 CTGGAGCACAGGAACCTGGAGGG - Intronic
1194197121 X:90908008-90908030 ATGGAGCAAAGAAAAGATGATGG + Intergenic
1195503920 X:105635154-105635176 CTGGAGCAAAGCAAAATTTGTGG + Intronic
1196093624 X:111774635-111774657 CTGGAGAAGAGCAAAATGGAGGG - Exonic
1198364895 X:135930339-135930361 CTGGGGCAGAGCAAAGTTCAAGG + Intergenic
1198570015 X:137944902-137944924 CTGGAGATAAGACAACTTGAAGG - Intergenic
1199792281 X:151166735-151166757 CTGGTGCAAAGAAAACTGGGTGG + Intergenic
1200019553 X:153190418-153190440 CTGGAGCAAAGTCCTCTTGAAGG + Intergenic
1200542975 Y:4482211-4482233 ATGGAGCAAAGAAAAGATGATGG + Intergenic
1201263001 Y:12178673-12178695 ATGGAACAAACCAAACTTCAGGG - Intergenic
1202169318 Y:22024244-22024266 CTGAAGCACAGGACACTTGAGGG + Intergenic
1202222044 Y:22562121-22562143 CTGAAGCACAGGACACTTGAGGG - Intergenic
1202321071 Y:23633546-23633568 CTGAAGCACAGGACACTTGAGGG + Intergenic
1202549696 Y:26036510-26036532 CTGAAGCACAGGACACTTGAGGG - Intergenic