ID: 1000334168

View in Genome Browser
Species Human (GRCh38)
Location 5:160229549-160229571
Sequence CCCAGCAGCATGGCTTTCAC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 186}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000334161_1000334168 2 Left 1000334161 5:160229524-160229546 CCCTCTGCTCTCTGGCCTCCAGC 0: 1
1: 0
2: 10
3: 116
4: 758
Right 1000334168 5:160229549-160229571 CCCAGCAGCATGGCTTTCACCGG 0: 1
1: 0
2: 1
3: 21
4: 186
1000334155_1000334168 27 Left 1000334155 5:160229499-160229521 CCTCAGCACCACCCATTCTCCTC 0: 1
1: 0
2: 3
3: 59
4: 539
Right 1000334168 5:160229549-160229571 CCCAGCAGCATGGCTTTCACCGG 0: 1
1: 0
2: 1
3: 21
4: 186
1000334153_1000334168 29 Left 1000334153 5:160229497-160229519 CCCCTCAGCACCACCCATTCTCC 0: 1
1: 0
2: 6
3: 68
4: 561
Right 1000334168 5:160229549-160229571 CCCAGCAGCATGGCTTTCACCGG 0: 1
1: 0
2: 1
3: 21
4: 186
1000334156_1000334168 19 Left 1000334156 5:160229507-160229529 CCACCCATTCTCCTCATCCCTCT 0: 1
1: 1
2: 4
3: 107
4: 1072
Right 1000334168 5:160229549-160229571 CCCAGCAGCATGGCTTTCACCGG 0: 1
1: 0
2: 1
3: 21
4: 186
1000334158_1000334168 15 Left 1000334158 5:160229511-160229533 CCATTCTCCTCATCCCTCTGCTC 0: 1
1: 0
2: 11
3: 169
4: 1411
Right 1000334168 5:160229549-160229571 CCCAGCAGCATGGCTTTCACCGG 0: 1
1: 0
2: 1
3: 21
4: 186
1000334160_1000334168 8 Left 1000334160 5:160229518-160229540 CCTCATCCCTCTGCTCTCTGGCC 0: 1
1: 1
2: 7
3: 122
4: 800
Right 1000334168 5:160229549-160229571 CCCAGCAGCATGGCTTTCACCGG 0: 1
1: 0
2: 1
3: 21
4: 186
1000334157_1000334168 16 Left 1000334157 5:160229510-160229532 CCCATTCTCCTCATCCCTCTGCT 0: 1
1: 0
2: 3
3: 71
4: 765
Right 1000334168 5:160229549-160229571 CCCAGCAGCATGGCTTTCACCGG 0: 1
1: 0
2: 1
3: 21
4: 186
1000334154_1000334168 28 Left 1000334154 5:160229498-160229520 CCCTCAGCACCACCCATTCTCCT 0: 1
1: 0
2: 5
3: 45
4: 574
Right 1000334168 5:160229549-160229571 CCCAGCAGCATGGCTTTCACCGG 0: 1
1: 0
2: 1
3: 21
4: 186
1000334162_1000334168 1 Left 1000334162 5:160229525-160229547 CCTCTGCTCTCTGGCCTCCAGCC 0: 1
1: 0
2: 29
3: 275
4: 1342
Right 1000334168 5:160229549-160229571 CCCAGCAGCATGGCTTTCACCGG 0: 1
1: 0
2: 1
3: 21
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000334168 Original CRISPR CCCAGCAGCATGGCTTTCAC CGG Exonic