ID: 1000335021

View in Genome Browser
Species Human (GRCh38)
Location 5:160235687-160235709
Sequence CTGGAGAGCTTCAGGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 624
Summary {0: 1, 1: 1, 2: 2, 3: 66, 4: 554}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000335021_1000335031 0 Left 1000335021 5:160235687-160235709 CCCTCCTCCCTGAAGCTCTCCAG 0: 1
1: 1
2: 2
3: 66
4: 554
Right 1000335031 5:160235710-160235732 CAGGGAAGACATGATGAGGGAGG 0: 1
1: 0
2: 3
3: 43
4: 464
1000335021_1000335030 -3 Left 1000335021 5:160235687-160235709 CCCTCCTCCCTGAAGCTCTCCAG 0: 1
1: 1
2: 2
3: 66
4: 554
Right 1000335030 5:160235707-160235729 CAGCAGGGAAGACATGATGAGGG 0: 1
1: 0
2: 1
3: 38
4: 463
1000335021_1000335029 -4 Left 1000335021 5:160235687-160235709 CCCTCCTCCCTGAAGCTCTCCAG 0: 1
1: 1
2: 2
3: 66
4: 554
Right 1000335029 5:160235706-160235728 CCAGCAGGGAAGACATGATGAGG 0: 1
1: 0
2: 2
3: 27
4: 274

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000335021 Original CRISPR CTGGAGAGCTTCAGGGAGGA GGG (reversed) Intronic
900159255 1:1215777-1215799 CTGGGCAGCTTCAAGCAGGAGGG - Intergenic
900206485 1:1433949-1433971 ATGGCGAGCTGAAGGGAGGAGGG + Intergenic
900310831 1:2032472-2032494 AAGGTGAGCTCCAGGGAGGAGGG - Intergenic
900587545 1:3440431-3440453 GTGGGGAGCTTCAGGGAGTGGGG - Intergenic
900896187 1:5484502-5484524 CTTGAGGGCTCCATGGAGGAAGG + Intergenic
901433079 1:9229868-9229890 CTGGAGAGGCTAAGGCAGGAGGG + Intergenic
901761597 1:11475292-11475314 GAACAGAGCTTCAGGGAGGAAGG + Intergenic
901813122 1:11778939-11778961 CTGGAGAGTGTCCGGGAGGGTGG - Exonic
903374522 1:22857512-22857534 CTGGAGAGCTTACAGTAGGATGG + Intronic
904008789 1:27378307-27378329 CAGGAGAGCCTGAGAGAGGAAGG + Intergenic
904287506 1:29461750-29461772 CTGGAGGGCTTCTGGGATGGAGG - Intergenic
904370769 1:30046116-30046138 CTGGAGGGCTTCTGAGACGAAGG - Intergenic
904381353 1:30113223-30113245 CTCCAGAGGTCCAGGGAGGAAGG + Intergenic
904417552 1:30372556-30372578 CTGGGGGGCTTCAGGGATGAAGG + Intergenic
904620737 1:31773559-31773581 ACTGAGAGCTTCAGGGAGGTAGG - Intergenic
905768104 1:40619994-40620016 CTGGAGGGCTCTTGGGAGGAGGG + Intergenic
906562357 1:46768535-46768557 CTGGAGAAATCCAGGTAGGAGGG - Intronic
906609677 1:47192703-47192725 GTGAAGACCTCCAGGGAGGAGGG - Intergenic
907237701 1:53062971-53062993 CGGGACAGCTGGAGGGAGGAAGG + Intronic
907240480 1:53078354-53078376 CTGGAGAGCTTCCTGGGGCAGGG - Exonic
907400520 1:54222269-54222291 CTGGAAGGCTTCCAGGAGGAGGG + Intronic
907593296 1:55696478-55696500 CTGGAGGGCTCCAGGGAGAGGGG + Intergenic
907798473 1:57740924-57740946 AAGGAGGGCTTCATGGAGGAGGG + Intronic
908407475 1:63829470-63829492 CTGGAAGGCTTCCAGGAGGAAGG + Intronic
908409793 1:63851879-63851901 CTGGAAAGATCCAGGGAAGATGG + Intronic
908644909 1:66266698-66266720 GTTGAGAGCTGCAGAGAGGAAGG + Intronic
910275514 1:85445289-85445311 GTGGGGTGCTTCAAGGAGGAGGG + Intronic
910721430 1:90290570-90290592 GGGGAGAGCAGCAGGGAGGAGGG + Intergenic
911857048 1:102891773-102891795 CTTGAGAGGCTAAGGGAGGAGGG + Intronic
912819501 1:112855462-112855484 CTGGATAGCTTCAGGATTGAGGG + Intergenic
913446919 1:118959945-118959967 CAGGAGAGATTCAGAGAAGATGG - Intronic
913582042 1:120235640-120235662 CAGGAGGGCTTCAGGGATGCTGG - Intergenic
913626132 1:120662751-120662773 CAGGAGGGCTTCAGGGATGCTGG + Intergenic
914448918 1:147773575-147773597 GGGGAGGGCTGCAGGGAGGAGGG - Intergenic
914563973 1:148847101-148847123 CAGGAGGGCTTCAGGGATGCTGG - Intronic
914608853 1:149283117-149283139 CAGGAGGGCTTCAGGGATGCTGG + Intergenic
915215893 1:154340631-154340653 CTGGAGAGCATCAGGAGGGTCGG + Intronic
915713992 1:157926734-157926756 ATGCAGAGCTCCAGGGAGGGAGG + Intergenic
916021603 1:160797248-160797270 CTCCAGGGCTTCAGGGATGATGG + Intronic
916893402 1:169136156-169136178 TTGGAGTGCTTCAAGGAGTATGG + Intronic
917808920 1:178638600-178638622 CTGGAGACCTAAAGGAAGGAAGG - Intergenic
918223324 1:182455951-182455973 CAGGAGACCTTAATGGAGGAAGG + Intronic
919090868 1:192977847-192977869 CTGGAGAGCTTCTTGGAAAAGGG + Intergenic
919172233 1:193969309-193969331 CTTGGGAGGCTCAGGGAGGATGG + Intergenic
919830408 1:201536894-201536916 ATGGACAGGTTGAGGGAGGAAGG - Intergenic
919988412 1:202691830-202691852 CAGGAAACCTGCAGGGAGGAGGG - Intronic
920049263 1:203153541-203153563 CTGCAGGGCTACAGGGAGGAGGG - Intronic
920296630 1:204961437-204961459 CGGGAGAGGTTCAGTGAGGTGGG - Intronic
920303854 1:205006436-205006458 AAGGGGAGATTCAGGGAGGAGGG + Intronic
920578208 1:207078843-207078865 ATGGGGAGGTTGAGGGAGGAGGG + Intronic
920912026 1:210227825-210227847 CTGGAAAGCTGCAGGGCAGATGG + Intergenic
920931702 1:210394749-210394771 CTGGAAGGCTGCAGGGAGCAGGG + Intronic
920961828 1:210670475-210670497 CTGAAGGCCTCCAGGGAGGATGG + Intronic
921433838 1:215092824-215092846 CTGAGGAGTTTCAGGGAGGTGGG - Intronic
922418335 1:225442294-225442316 TTGGAGAGCATCATGGTGGAGGG - Intergenic
922562706 1:226580626-226580648 CAGGAGGGCTTCTGAGAGGAAGG - Intronic
923063412 1:230497412-230497434 CTAGAGAGCGTGAGGGAGAAAGG + Intergenic
923276011 1:232396986-232397008 CTGGAGATTTTCAGGGAATAAGG - Intergenic
923401339 1:233618109-233618131 GGGCAGAGCTTCAGGGAAGAAGG + Intronic
924199621 1:241645496-241645518 CTGGAGAACTTCTGTGAGGGTGG + Intronic
924861271 1:247925079-247925101 CTGGACACCATGAGGGAGGAAGG + Intergenic
1062768019 10:80232-80254 AGGGGCAGCTTCAGGGAGGAAGG - Intergenic
1062824538 10:557945-557967 CTGGAGGGCTGGAGGCAGGAGGG + Intronic
1063233895 10:4092568-4092590 CTGACGAGCTTCTGGGAGGCAGG + Intergenic
1064128443 10:12685717-12685739 CTGGAGAGATTGAGAGAGAAAGG + Intronic
1064632402 10:17329979-17330001 CTGGAGAGTTTCATGCAGAAGGG + Intronic
1065260626 10:23919879-23919901 CTGGAGAAGGTCAGGAAGGAAGG - Intronic
1065364415 10:24921424-24921446 CCTGAGAGCTGCAGAGAGGAAGG + Intronic
1067027826 10:42859239-42859261 CTGGTGGGTTTCAGGGAGGCAGG - Intergenic
1067832595 10:49618953-49618975 TTGGAGAGATTCGGAGAGGAAGG + Intronic
1068159031 10:53239822-53239844 CTGCAGAGTTTCAGAGAGGAAGG - Intergenic
1068749070 10:60570604-60570626 CTGGAGAGCTTCAGGCCCTATGG + Intronic
1069307465 10:66988844-66988866 GTGGAGAGAAACAGGGAGGAGGG - Intronic
1069481431 10:68785760-68785782 CTGAAGAGGTTCAGGGAAGATGG - Intronic
1069569814 10:69487522-69487544 CTGGAAAGCCTCAGGGCGGCCGG - Intronic
1069608033 10:69752553-69752575 CAGGAGAGAGTCAGGGAGGATGG + Intergenic
1070467434 10:76737753-76737775 GTGCAAAGCTTCAGAGAGGATGG + Intergenic
1070556219 10:77529708-77529730 CTGGAGAGGTTCTGGGATCAGGG - Intronic
1070794919 10:79210861-79210883 ATGGAGGGCTTCCTGGAGGAGGG + Intronic
1071251479 10:83823968-83823990 CTGGAGAGCCTGGGGAAGGAAGG - Intergenic
1071562520 10:86655237-86655259 ATGGAGCCCTCCAGGGAGGAGGG + Intronic
1071730433 10:88243292-88243314 CAGCAGAGCTTCAGGGAAAATGG - Intergenic
1072037244 10:91574796-91574818 CTGTAGAGCTCCAGGGAGCTTGG + Intergenic
1072040229 10:91600109-91600131 CTGGAGTGCTGCAGGGAGCCTGG - Intergenic
1072683447 10:97523001-97523023 CTGGAGATCTCCAGGTAGGCAGG - Intronic
1072717084 10:97759427-97759449 CTGGAGAGAGTGAGGAAGGAAGG - Exonic
1073053429 10:100684023-100684045 CTGGGGGGCTGCAGGGGGGAGGG + Intergenic
1073347231 10:102792939-102792961 CAGAACAGCTTCTGGGAGGAAGG - Intronic
1073439267 10:103543152-103543174 CTGCAGGACTACAGGGAGGAGGG - Intronic
1075186566 10:120264649-120264671 CAAGGGAGCTTCAGGGAGAAGGG - Intergenic
1075321283 10:121493490-121493512 CATGGGAGCTTCAGGAAGGAGGG - Intronic
1075687017 10:124371314-124371336 CTGGAGAGCCTCAAGCAGAAAGG - Intergenic
1076113600 10:127880134-127880156 CTGGAGAGCTTCAGAGGGTCAGG - Intronic
1076500251 10:130931035-130931057 CTGGAAAGCCTCAGGGAGAGTGG + Intergenic
1076999434 11:315366-315388 CCTGAGAGCTTCACAGAGGAGGG - Intergenic
1077104581 11:836629-836651 CAAGAAAGCTTCAGGGAGGGTGG + Intronic
1078444851 11:11396411-11396433 ATGGAGAGCTGCAGGGATGATGG + Intronic
1078529609 11:12126859-12126881 CTGGAAAGCTTCCTGGAGGAGGG + Intronic
1078539944 11:12205267-12205289 CTGCAAAGCTGCAGGAAGGAAGG - Intronic
1078852401 11:15176863-15176885 CTGGGAAGCTTCAGGAAAGAAGG - Intronic
1079035067 11:17014007-17014029 GAGGAGGGCTTCACGGAGGAGGG - Exonic
1079505074 11:21144118-21144140 CTGGAGAGTTTCTGGGGAGAAGG + Intronic
1079586116 11:22128469-22128491 CTGCAGAGCTACAGGGACGGAGG - Intergenic
1080258005 11:30314043-30314065 CTGGAGTGGTTCCTGGAGGAGGG - Intergenic
1080748687 11:35132293-35132315 CTGGAGAAGATCTGGGAGGATGG + Intergenic
1080891973 11:36416964-36416986 CTGGAGAGCAGCACGGAGGAGGG - Intronic
1081962800 11:47150738-47150760 AAGGACAGCTTCAGGGAGGATGG + Intronic
1082004845 11:47413812-47413834 CAGGACAGCAGCAGGGAGGATGG - Intronic
1082162774 11:48901946-48901968 TTGGAGAGCGTCCTGGAGGAGGG - Intergenic
1082243503 11:49893539-49893561 GTGGAGAGCGTCCTGGAGGAGGG - Intergenic
1083304238 11:61754438-61754460 TTTGAGACCTTCAGGGAAGAGGG + Intronic
1083433954 11:62630132-62630154 CGAGAGAGATTCAGGGAGGCAGG + Intronic
1083439150 11:62664781-62664803 CCGGAGCTCTGCAGGGAGGAAGG + Intronic
1083891486 11:65597982-65598004 CTGGGGTGATGCAGGGAGGAGGG - Exonic
1084157190 11:67320358-67320380 ATGGTGAGCTTCTGGGAGGCAGG + Intronic
1084319113 11:68363778-68363800 CCGGAGAGCGTCAGGGCGAAGGG - Exonic
1084715308 11:70869893-70869915 CTGGGGAGCTTCAGGCAGAGGGG - Intronic
1085052981 11:73389221-73389243 CTGGAGGGCTGCAGGGCTGAGGG - Intronic
1085642775 11:78203217-78203239 CTGGAAAGCTTCATAGAGAAGGG + Intronic
1085910392 11:80817915-80817937 CTGGAGAGCTCCACGTAGGATGG - Intergenic
1086697928 11:89865362-89865384 GTGGAGAGCGTCCTGGAGGAGGG - Intergenic
1086708234 11:89979126-89979148 GTGGAGAGCGTCCTGGAGGAGGG + Intergenic
1087530032 11:99368912-99368934 CTGGAGAATGTCAGGGAAGAGGG + Intronic
1088817056 11:113428586-113428608 GTGGAGAACTTCCTGGAGGAGGG + Intronic
1088866683 11:113854258-113854280 CTTCAGAGCTTCATGGAGAAAGG + Exonic
1089179223 11:116569461-116569483 CTGGAGAGCTTCAGGGAGCAGGG + Intergenic
1089764448 11:120752651-120752673 CCTGAGAGCTGCAGGGAGGGTGG - Intronic
1090304960 11:125683411-125683433 CTGAAAATCTTCAGGGTGGAGGG + Intergenic
1090844658 11:130520505-130520527 CTGGGAGGCGTCAGGGAGGAAGG + Intergenic
1091078496 11:132643437-132643459 ATGCAGAGCCTCAGGGAGGCTGG + Intronic
1091233080 11:134000938-134000960 CTGGAGAGTTTCGTGGAGGGTGG - Intergenic
1091382276 12:69650-69672 AAGGAGAGCTGCAGGGATGAGGG - Intronic
1091457612 12:619398-619420 CTGAAGAGCTTCATGGAGTGGGG + Intronic
1091476082 12:774247-774269 CTTGGGAGCTGCAGGGAGAAGGG - Intronic
1091602312 12:1925386-1925408 CTGGAAACCTCCTGGGAGGACGG + Intergenic
1091602340 12:1925486-1925508 CTGGAAACCTCCTGGGAGGATGG + Intergenic
1091602354 12:1925536-1925558 CTGGAAACCTCCTGGGAGGATGG + Intergenic
1091671309 12:2454061-2454083 CTGGAGGGCTCCAGGGAGGTGGG - Intronic
1091869971 12:3881290-3881312 CAGGAGAGGGTGAGGGAGGAAGG + Intergenic
1091879352 12:3964397-3964419 CTGGGGCGCTTCAGGAATGAAGG - Intergenic
1091927972 12:4370869-4370891 CTGCAGAGCTTCAGGCCGGCTGG - Intronic
1092167581 12:6352381-6352403 CTGGAGATCTTTAGGAAGAAGGG + Intronic
1092214677 12:6672645-6672667 CTGGAGTGTTTTTGGGAGGAGGG - Intronic
1094063653 12:26341108-26341130 TTGCAGAGCTTTGGGGAGGATGG - Intronic
1095251925 12:39989166-39989188 ATGGAGAGTTTCAGGGGGTAAGG - Intronic
1095278149 12:40315454-40315476 TTGAAGAGCTTCATGGAAGAAGG + Intronic
1095882914 12:47157480-47157502 CTGGGGAGGTTGAGGCAGGAAGG + Intronic
1096154329 12:49333338-49333360 CTGGGGAGGACCAGGGAGGAGGG + Intronic
1096177844 12:49534862-49534884 CTGGGGACCTCCAGAGAGGAAGG + Intergenic
1096570785 12:52521894-52521916 CTTCAAAGCCTCAGGGAGGAGGG + Intergenic
1096718729 12:53505968-53505990 CTGGAGAGCAAGAGAGAGGAGGG - Intronic
1096743205 12:53709528-53709550 TTGGGGGGCTTCATGGAGGAGGG + Intronic
1096800893 12:54109821-54109843 CTGGAGATGTCCAGGGATGAAGG - Intergenic
1096975711 12:55698347-55698369 CTGGAAAGGCTCAGGGAGGGAGG - Intronic
1096994819 12:55831798-55831820 CTGAAGAGCTGCAGGGTGGTGGG + Intergenic
1101594180 12:106149227-106149249 CTGGAGAACTTCAGGTTTGAAGG - Intergenic
1101621725 12:106395401-106395423 CAAGAGAGCGTGAGGGAGGAGGG + Intronic
1102638679 12:114347033-114347055 CAAGAGAGCTTCATGGAGGCAGG - Intergenic
1103513110 12:121488914-121488936 CTCGAGAGGCTCAGGCAGGAAGG - Intronic
1104519400 12:129459091-129459113 ACAGAGACCTTCAGGGAGGAGGG - Intronic
1104747926 12:131221607-131221629 CTGGAGGGCTTCCTGCAGGAGGG - Intergenic
1105829122 13:24148806-24148828 CTGGAAAGCTTGAGGAAGGCAGG + Intronic
1106144642 13:27040212-27040234 CTGCGGAGCGTCAGGGAGCACGG - Intergenic
1106486369 13:30176401-30176423 TTGGAGAGCATCAAGGAAGATGG - Intergenic
1106644113 13:31614471-31614493 CTGGAGAGTTTCATGGGGGCTGG - Intergenic
1106650386 13:31683973-31683995 CTTGAGGGCTTTGGGGAGGAGGG + Intergenic
1107092503 13:36497084-36497106 CTGAAGAGCTTCAGGGATAGAGG + Intergenic
1107958310 13:45538757-45538779 TGGGAGAGCCTCAGGGAGAAGGG + Intronic
1108704379 13:52972035-52972057 AGGGAAAGCTTAAGGGAGGAAGG + Intergenic
1108728363 13:53205312-53205334 ATGGAGAGTGACAGGGAGGAGGG - Intergenic
1110620172 13:77586010-77586032 ATGGAGAGTTTCAGGGAGGAGGG - Intronic
1112709913 13:102115682-102115704 GTGGAGAGGGTCAGGGAGCATGG + Intronic
1113760035 13:112840571-112840593 CTGGAGGGCATGGGGGAGGACGG - Intronic
1113853140 13:113429266-113429288 ATGGGGAGTTCCAGGGAGGATGG - Intronic
1114886467 14:26858101-26858123 CTGGAGTCCTTCAGAGAGAAAGG + Intergenic
1115731281 14:36272304-36272326 CTGGGGAGCTTTGGGGAGCAGGG - Intergenic
1115996774 14:39203331-39203353 CTGGAGATCATCATGGCGGATGG + Intergenic
1116633959 14:47369535-47369557 CTGGAGGACTGCAGGGTGGAGGG - Intronic
1119391373 14:74293280-74293302 CTGGAGAGGTTCAGCCAGGTTGG + Intronic
1120966122 14:90169199-90169221 CTGCCAAGCTTCAGAGAGGATGG - Intronic
1121545170 14:94757906-94757928 CTGGAGAGCAACATGGAGCATGG + Intergenic
1121670824 14:95709636-95709658 AGGGACAGCTTCAGGCAGGAGGG + Intergenic
1121917465 14:97848866-97848888 AAGGAGACCTGCAGGGAGGAGGG - Intergenic
1122266039 14:100547328-100547350 CTGGAAGGCTTCCTGGAGGAAGG - Intronic
1123427477 15:20184069-20184091 CTTGTGGGCTTCAGGGAGGCAGG - Intergenic
1123536713 15:21190619-21190641 CTTGTGGGCTTCAGGGAGGCAGG - Intergenic
1123658261 15:22540917-22540939 CTGGCGAGCTCCAGGGCAGAGGG + Intergenic
1124053501 15:26220859-26220881 CGGGAGAGCTTGAGAGAGAAGGG + Intergenic
1124312126 15:28635409-28635431 CTGGCGAGCTCCAGGGCAGAGGG + Intergenic
1124439788 15:29677663-29677685 CTGGAGGGCTTCGTGGAGGAAGG + Intergenic
1125979933 15:43991249-43991271 CTGGAGAGGATCTGGGAGAAAGG - Intronic
1126284629 15:46996832-46996854 CTGCGGAGCTCCTGGGAGGAGGG - Intergenic
1127626675 15:60786781-60786803 CGGGTGAGCATCAGGGAGGGAGG - Intronic
1128607912 15:69051061-69051083 AAGGAGAGATGCAGGGAGGAGGG - Intronic
1129156213 15:73719742-73719764 CCAGAGAGCTGCAAGGAGGAGGG - Intergenic
1129697997 15:77751564-77751586 CTGGAGGGCTTCCTGGAGAAGGG + Intronic
1129958156 15:79658172-79658194 GTGGAGAGCTAAAGGAAGGATGG + Intergenic
1131074488 15:89486722-89486744 CAGGTGAGCCTGAGGGAGGAGGG - Intronic
1131521272 15:93117972-93117994 ATGGTGAGCATCAGGAAGGAAGG - Intergenic
1132744621 16:1431552-1431574 GGGGAGGGCTTCAGGGAGGGAGG - Intergenic
1132943374 16:2519433-2519455 CTGGAGGACTGCAGGGAGGGGGG + Intronic
1133324541 16:4935282-4935304 ATGGAGAGCTGCACGAAGGAGGG + Intronic
1133350057 16:5095398-5095420 CTGGAGAGATTCAGGAGGCAGGG + Intronic
1133371551 16:5249239-5249261 CTGGGGGCCTTCAGGAAGGATGG + Intergenic
1134098288 16:11434097-11434119 CGGGAGGGCTTCCTGGAGGAGGG - Intronic
1134694608 16:16214330-16214352 CTGGGGGTCTTCAGGGAAGAAGG + Exonic
1134977228 16:18580307-18580329 CTGGGGGTCTTCAGGGAAGAAGG - Intergenic
1135590364 16:23700828-23700850 CTGGGGAGCTGCTGGGAGGGAGG + Intronic
1135818892 16:25661603-25661625 CTGTATATATTCAGGGAGGAAGG - Intergenic
1135978664 16:27129122-27129144 TTGGACAGTTTCTGGGAGGAGGG - Intergenic
1136019513 16:27431042-27431064 CTGGAGGGCTTCCTGGAGGAGGG + Intronic
1136227072 16:28866416-28866438 CTTGAGAGCTGCAGGGTGGGTGG + Exonic
1136628833 16:31477550-31477572 CCGAAGAGCTTCAGGAAGCAGGG - Exonic
1136856818 16:33665740-33665762 CTGGTGGGTTTCAGGGAGGCAGG + Intergenic
1138211263 16:55165024-55165046 CTGGATGGCTTCAGAGAGGAGGG + Intergenic
1138658895 16:58506543-58506565 CCGGAGAGCTGCAGGGAGCAGGG - Exonic
1140225097 16:73070778-73070800 CTGGAGAGAGGCAGAGAGGATGG - Intergenic
1140702830 16:77598316-77598338 GAAGAGAGGTTCAGGGAGGAAGG + Intergenic
1141114040 16:81293257-81293279 CTGGAGAGCTCCTGGGAGATGGG + Intergenic
1141531106 16:84647942-84647964 CTGGAGGGCTTCTGGTAGGGAGG + Intergenic
1141861187 16:86717705-86717727 CAGGAGGGCTTCATGGAGGAGGG + Intergenic
1142376010 16:89707490-89707512 CTGGGGAGCATCAGGGAAGAGGG - Exonic
1203118391 16_KI270728v1_random:1514215-1514237 CTGGTGGGTTTCAGGGAGGCAGG + Intergenic
1142614716 17:1127587-1127609 CTGGAGAGGAGGAGGGAGGAGGG - Intronic
1143455587 17:7065546-7065568 CTTGAGAGCCTCAGTGAGGAGGG - Intergenic
1143983423 17:10890626-10890648 CTGGAAAGCCTCAGAGAGGTGGG + Intergenic
1145304402 17:21665368-21665390 ATAGAGAGATTCTGGGAGGAGGG + Intergenic
1146636808 17:34512494-34512516 CTAAAGGGCTTCAGGCAGGAGGG + Intergenic
1146720309 17:35119382-35119404 CTGGAGAGGCTCAGGAAGGGTGG - Intronic
1147015920 17:37490972-37490994 CTGTAGAATGTCAGGGAGGACGG - Intronic
1147960943 17:44167284-44167306 CTTGTGTGCCTCAGGGAGGAAGG + Intergenic
1148185783 17:45642796-45642818 CTGGAGAGCTACCAGGAGAATGG - Intergenic
1148746522 17:49921207-49921229 CAGGAGGGCTTCTTGGAGGAGGG + Intergenic
1148857287 17:50585664-50585686 CTGGAGAGCTTCCGGGGGCTGGG + Intronic
1149435980 17:56633899-56633921 CTGAACAGCTTCAGGAAGGGAGG - Intergenic
1149512282 17:57253824-57253846 CTGGAGCTCTTCAGGAAGGGTGG + Intergenic
1149698731 17:58637594-58637616 ATGGAGAGGTTCCTGGAGGATGG + Intronic
1150133475 17:62681507-62681529 CTGGGGGGCTTGAGGCAGGAAGG + Intronic
1150508790 17:65726412-65726434 CAGCAGAGCTTCATGGAGGAGGG + Intronic
1151210230 17:72538936-72538958 CTGGAGAGAAACTGGGAGGAGGG + Intergenic
1151350165 17:73527145-73527167 CAGGGGAGCTCCAGGGAGGAAGG + Intronic
1151439059 17:74116440-74116462 CAAGAGAGCGTCTGGGAGGAGGG + Intergenic
1151451383 17:74200322-74200344 CTGGAAGGCTTCGTGGAGGAGGG - Intergenic
1151680956 17:75622467-75622489 CTAGTGAGCTGCAGGGAGAACGG + Intergenic
1151696844 17:75722198-75722220 CTGTAGAGCTTCCTGAAGGAAGG - Intronic
1151799187 17:76367566-76367588 CTGGAGGGGTTCAGTCAGGATGG + Intronic
1151956332 17:77381915-77381937 CGGGAGGGCTTCCTGGAGGAAGG + Intronic
1152228106 17:79102006-79102028 CTTGGCAGCCTCAGGGAGGAGGG - Intronic
1152408465 17:80110446-80110468 CCAGAGAGCGTCAGGGAGAAGGG - Intergenic
1152809708 17:82375666-82375688 CTGGAGACCCTCAGGGAGGCGGG - Intergenic
1152973781 18:192854-192876 CTTGAGAGCTTCAGGGGAAATGG + Exonic
1153594264 18:6708456-6708478 CAGGTGTGTTTCAGGGAGGAAGG + Intergenic
1153631299 18:7072865-7072887 CTGGAGGGCTGGAGGGAGGCAGG + Intronic
1157155938 18:45266125-45266147 CTTGAGACCTACAGGAAGGATGG + Intronic
1157478224 18:48036764-48036786 CTGAAGAGCTTCCAGGTGGAAGG + Intronic
1158301957 18:56062439-56062461 CTGGACAGCTTCAAGGAGCAAGG + Intergenic
1158410581 18:57201830-57201852 CTGGAGAGCTTTTGGGAGCTAGG + Intergenic
1158519931 18:58163432-58163454 CTGCAGCGCTTCAGGGAACAGGG + Intronic
1159513394 18:69426267-69426289 CTGGACAGCTTTGGAGAGGAAGG - Intronic
1159622166 18:70651107-70651129 CTGTAGGGCTTTAGGGAGGATGG + Intergenic
1159632518 18:70765298-70765320 ATAGAGACCTCCAGGGAGGAAGG + Intergenic
1160718380 19:586712-586734 CTGGGGAGGTTCAGCGAGGAGGG + Intergenic
1160812615 19:1019490-1019512 CTGGGGGGCTGCAGGGAGGAAGG + Intronic
1160824379 19:1072828-1072850 CTGGTGGGCTGCATGGAGGAAGG + Intronic
1160881809 19:1324398-1324420 CAGGAGGGCTTCCTGGAGGAGGG + Intergenic
1161227097 19:3151720-3151742 CTGGAGCGCATCACCGAGGAGGG + Exonic
1161326785 19:3667974-3667996 CTGGAGAGGGGCAGGGAGGGCGG - Intronic
1161422504 19:4183578-4183600 CGGGAGGGCTTCCTGGAGGAGGG + Intronic
1161593179 19:5137842-5137864 CTGGGGAACTTCAGGAAGGTCGG - Intronic
1162066422 19:8128145-8128167 TTGGAGAGCTTCTAGGTGGATGG - Intronic
1162750292 19:12825568-12825590 CTCTGGAGCTCCAGGGAGGAGGG + Exonic
1162935815 19:13980949-13980971 CAGGAGAGCTTCAGGGGTGCTGG - Intronic
1163106128 19:15124040-15124062 CAGGAGGGCATCAGGGAGGCTGG - Intronic
1163216973 19:15886123-15886145 ATTGAGGGCCTCAGGGAGGATGG + Intronic
1163254011 19:16143893-16143915 GGGGAGAGCTTCGTGGAGGAGGG + Intronic
1163512141 19:17741645-17741667 ATGGAGGGCTTCCTGGAGGAAGG + Intergenic
1163512159 19:17741710-17741732 ATGGAGGGCTTCCTGGAGGAGGG + Intergenic
1163641444 19:18464702-18464724 GTGCCGGGCTTCAGGGAGGAGGG - Intronic
1163760250 19:19132602-19132624 GTGGAGACCTTCAGGGCTGAGGG + Intronic
1164932038 19:32183351-32183373 GTGGAGAGCTTCAGTGAACATGG - Intergenic
1165668685 19:37655875-37655897 CTGGGGCCCTTCAGGGAGCAAGG + Intronic
1165832631 19:38736971-38736993 CTGAAGAGGATCGGGGAGGAGGG - Intronic
1165843206 19:38801903-38801925 ATGGACAGCTGCAGGGAGAAGGG + Exonic
1165891911 19:39117728-39117750 CTGAAGATCTGGAGGGAGGAAGG - Intergenic
1165901238 19:39170216-39170238 CAGGCAAGCTTCTGGGAGGAGGG + Intronic
1166007587 19:39917853-39917875 CTGGAGGGGTCCAGGCAGGATGG - Intronic
1166562004 19:43739059-43739081 CTGAAGAGCTTCGGGCAGGCAGG + Intronic
1166617197 19:44260683-44260705 CCGGAGGGCTGCAGAGAGGAGGG + Intronic
1166760080 19:45218601-45218623 ATGGAGGGCTTCCTGGAGGAGGG + Intronic
1166842914 19:45709875-45709897 GTGTAGTGCTTCTGGGAGGAAGG + Intergenic
1166876386 19:45900422-45900444 CAGGAGGGCTTCCTGGAGGAGGG - Intronic
1167015751 19:46839840-46839862 CAGGAGGGCTTCCTGGAGGAGGG + Intronic
1167383167 19:49150021-49150043 CTGGAGAGGAACAGGGAGGAGGG + Intronic
1167465000 19:49645985-49646007 CTGGAGAGCATGCGGGAGGCTGG + Intronic
1167669139 19:50839458-50839480 CTGGGGAGTCTGAGGGAGGAGGG + Intergenic
1167740838 19:51324097-51324119 CAGGAGAGCTACAGGGATGAGGG + Intronic
1167779664 19:51590862-51590884 CTGACCAGTTTCAGGGAGGAAGG + Exonic
925047619 2:785993-786015 TGGGAGAGCTACAGGAAGGAAGG + Intergenic
925595506 2:5551977-5551999 CTGGAGAGGGTGAGGGAGCAGGG + Intergenic
926335026 2:11856693-11856715 AGGGAGAGCTTGAGGAAGGAGGG + Intergenic
927140173 2:20124824-20124846 CTGGAGAGTGTCAGGGCGGGAGG + Intergenic
927203995 2:20595491-20595513 CAGGAGGGCTTCCTGGAGGAGGG + Intronic
927390125 2:22585505-22585527 CTGGAAAGCTTCAGGTAGGCTGG - Intergenic
927464015 2:23323690-23323712 CTGCAGAGGAACAGGGAGGAAGG + Intergenic
927487724 2:23500238-23500260 CAGGAGGGCTTCATGGAAGAGGG + Intronic
927515257 2:23668536-23668558 CTGCAGAAGTCCAGGGAGGAGGG + Intronic
928086110 2:28347419-28347441 CTGGAGGGCTTCCTGGAGGAGGG + Intergenic
929170397 2:38926685-38926707 CTGGGGTTCTGCAGGGAGGAAGG + Intronic
929562138 2:42962530-42962552 CTGGAGGGGTTGGGGGAGGAGGG + Intergenic
930220022 2:48736659-48736681 CTGGAGAGCTTCAGTCAGGTGGG + Intronic
930912144 2:56641815-56641837 GGGGAGAGGTTCAGGGAGAATGG + Intergenic
932369344 2:71174567-71174589 GTGGAGAGCTGCAGAGGGGAAGG + Intergenic
932409299 2:71535677-71535699 GAGCAGAGCTTCAGGGAGGATGG + Intronic
932816342 2:74865170-74865192 GAGGAGGGCTGCAGGGAGGAGGG + Intronic
933702057 2:85262771-85262793 CTGGAGAACTTATTGGAGGATGG - Intronic
934578490 2:95418600-95418622 GTAGAGAGCTTCAGGAAGGAGGG + Intergenic
934588305 2:95525544-95525566 TTGGAGAGCGTCCCGGAGGAGGG + Intergenic
934600954 2:95658113-95658135 GTAGAGAGCTTCAGGAAGGAGGG - Intergenic
934603818 2:95679369-95679391 TGGGAGGGCTTCATGGAGGAAGG + Intergenic
934853610 2:97716076-97716098 ATGGAATGCTTCTGGGAGGATGG + Intronic
934876232 2:97923512-97923534 CTTGAGAGGCTGAGGGAGGAGGG + Intronic
934983318 2:98865764-98865786 CTTGACACCTTCAGGGAGAAAGG - Intronic
935096512 2:99949398-99949420 CTGGAGAGCAGGGGGGAGGATGG + Intronic
935456891 2:103280401-103280423 CTACAGAGCTTCATGGATGATGG + Intergenic
935782282 2:106518872-106518894 TTGGAGGGCTGAAGGGAGGACGG - Intergenic
935987732 2:108690831-108690853 CTGGGGAGGTTGAGGCAGGAGGG - Intergenic
936126560 2:109793535-109793557 CTGGGGAGGTTGAGGCAGGAGGG - Intronic
936218133 2:110577933-110577955 CTGGGGAGGTTGAGGCAGGAGGG + Intergenic
936534326 2:113300262-113300284 GTAGAGAGCTTCAGGAAGGAGGG - Intergenic
936537196 2:113321596-113321618 TGGGAGGGCTTCATGGAGGAAGG + Intergenic
936650767 2:114423473-114423495 CTGGTGAACCTCAGGGAAGAAGG + Intergenic
936972533 2:118188855-118188877 CTGGCTAGCTGCATGGAGGATGG + Intergenic
937584921 2:123535223-123535245 CTGGAGAGGTTCAGGGTATAAGG + Intergenic
938570845 2:132560641-132560663 CTGGAGAGCTATAGGGAGACTGG - Intronic
939481346 2:142751534-142751556 CTGGAAACTTTTAGGGAGGATGG - Intergenic
940885300 2:158984709-158984731 GGGGAAAGCTTCAGGGAGGAGGG + Intronic
941763024 2:169265319-169265341 CTGGTGAGCTTCAGGCAGGAAGG - Intronic
942634300 2:177986185-177986207 CTGGAGACCTTCAGGAAAGTGGG + Intronic
942752549 2:179304237-179304259 CTGGAGAACAGCAGGGAGGTGGG - Intergenic
944880563 2:204008590-204008612 CTAGAGAGCTCCTGGGAGGCAGG + Intergenic
944893655 2:204142650-204142672 CAGCAGAGGATCAGGGAGGAGGG - Intergenic
946777557 2:223159151-223159173 CTGGGAAGCTTCAGGCAGGTAGG + Intronic
946909108 2:224442747-224442769 CCGGAAAGCTTCCTGGAGGAGGG + Intergenic
947111203 2:226721403-226721425 CAGGAGAGCTGGAGGGAGCAAGG + Intergenic
947451067 2:230209475-230209497 AAGGAGAGGATCAGGGAGGAAGG + Intronic
947677487 2:231996045-231996067 CTAGAGAGGTTCAAGAAGGAAGG + Intronic
948364241 2:237444452-237444474 CAGGAGAGCTGCTGGGAGGGAGG - Intergenic
948610105 2:239161645-239161667 CTGGGGACCTTCAGGCTGGAGGG - Intronic
948660395 2:239503153-239503175 CTCGAGAGCTTCCGGGAAGGAGG - Intergenic
1169881447 20:10351410-10351432 CTAGAGAGCTTCAGGATGGGGGG - Intergenic
1170822661 20:19767496-19767518 CTGGCTAGCCTCAGGGAGGATGG + Intergenic
1171521921 20:25782800-25782822 ATAGAGAGATTCTGGGAGGAGGG + Intronic
1171554904 20:26073083-26073105 ATAGAGAGATTCTGGGAGGAGGG - Intergenic
1171852666 20:30319617-30319639 CTGGAGATGTCCAGGGATGAAGG - Intergenic
1172215333 20:33231689-33231711 CGGGAGGGCTCCAGGGAAGATGG + Intergenic
1172869623 20:38127970-38127992 CTCGAGGGCTTCAGATAGGATGG + Exonic
1172887722 20:38242223-38242245 CTGGATAGATGCAGAGAGGAAGG - Intronic
1172922498 20:38497115-38497137 CTCGAAAGCTTCTGGGAGGAAGG - Intronic
1172940428 20:38650170-38650192 CTGGAGGGCTGGAGGGTGGAGGG - Exonic
1173137421 20:40451520-40451542 CTTGGTAGTTTCAGGGAGGATGG - Intergenic
1173197167 20:40925110-40925132 CTGGAGAGCAGGAGGGAGGTGGG + Intergenic
1173448716 20:43143264-43143286 CTGGAAAGTTGAAGGGAGGAGGG - Intronic
1173793051 20:45840624-45840646 GTGTAGAGCTGCAGGGAGGGTGG - Exonic
1173840820 20:46155805-46155827 ATGGAGAGCTTCAGGAAGGCAGG + Intergenic
1174225264 20:48993692-48993714 CAGCTGAGCTTCAGGTAGGAGGG + Intronic
1174508075 20:51029812-51029834 TTGGAGAGAGTCAGGCAGGAGGG + Intergenic
1174619035 20:51859901-51859923 CTGGACAGCTGCAGGGATGGAGG + Intergenic
1175092994 20:56520172-56520194 CTGGCCAGCTTGAGGGAAGAAGG + Intronic
1175303749 20:57961474-57961496 TTGGAGATCAGCAGGGAGGAGGG - Intergenic
1175480032 20:59304131-59304153 CTACAGAGTTTCAGGAAGGAAGG - Intronic
1175581377 20:60102406-60102428 CTGGAGACCTTCAGGGTAGCAGG + Intergenic
1175607041 20:60319527-60319549 CTGCAGAGCTGCAAGGTGGAGGG - Intergenic
1175676575 20:60951254-60951276 CTGGAGAGGTGCGGGGAGGGCGG + Intergenic
1175876990 20:62235040-62235062 CTGGAGAGCTGCGGCGGGGAGGG + Intronic
1175940711 20:62536359-62536381 CAGGAGGGCTTCCTGGAGGAAGG - Intergenic
1176110278 20:63407754-63407776 CTGGAGAGGTACAGGGAGGGGGG + Intronic
1176190095 20:63804448-63804470 CGGGAGGGCTTCCTGGAGGAGGG - Intronic
1176655729 21:9587796-9587818 ATAGAGAGATTCTGGGAGGAGGG + Intergenic
1176656285 21:9591409-9591431 CTGGGGATCTGCAGGGAGGTCGG + Intergenic
1178072443 21:28983655-28983677 ATGGAGAGCCACAGGAAGGATGG + Intronic
1179262055 21:39766019-39766041 AGGGAGAGCATGAGGGAGGAAGG - Intronic
1179513953 21:41893649-41893671 CTGGAGAGCGTGAGTGAAGATGG - Intronic
1179524022 21:41964079-41964101 CTGGGGAGATTTAGAGAGGAAGG - Intergenic
1179708436 21:43195626-43195648 GAGCAGCGCTTCAGGGAGGAGGG + Intergenic
1180655766 22:17419218-17419240 CGCGGGAGCTTCTGGGAGGAGGG - Intronic
1181028411 22:20138521-20138543 CTGGAAAGCTTCCCGGAAGAGGG + Intronic
1181643183 22:24215502-24215524 CTGGAGTGCTTCAGTGTGGTGGG - Intergenic
1182108683 22:27707330-27707352 CAGGAGGGCTTTATGGAGGAGGG + Intergenic
1182139276 22:27938831-27938853 CTGAAGAGGTTGAGGCAGGAGGG + Intergenic
1182266446 22:29119501-29119523 CTGGATAGCTTCAGGATGGAGGG - Intronic
1182602348 22:31475956-31475978 GGGGAGGGGTTCAGGGAGGATGG + Intronic
1183370580 22:37429484-37429506 CTGGAGGTCTCCAGGGAGAAGGG - Intergenic
1183414806 22:37676073-37676095 CGGGACAGCTGCAGGGGGGAGGG - Intronic
1183573433 22:38671458-38671480 CGGGAGAGCTTCCCAGAGGAAGG + Intronic
1183818410 22:40323204-40323226 CTGGTGACCTTCTGGGAGGAGGG + Exonic
1183829555 22:40410527-40410549 GTGGAGAGCTCCTGGCAGGAAGG + Exonic
1184333457 22:43840184-43840206 CAGGAGAGCGTCAGGTAAGAGGG + Intronic
1184448860 22:44571031-44571053 TTGCAGGGCTTTAGGGAGGAGGG + Intergenic
1184480909 22:44746341-44746363 ATGGAGAATTTCAAGGAGGAGGG - Intronic
1185339383 22:50284715-50284737 CTGCAGGGGTTCTGGGAGGAGGG - Intronic
949511027 3:4767347-4767369 CTGGAGATATTCTGGGAGTAGGG - Intronic
950892311 3:16414897-16414919 TTGGAGAGCCTCAGGGGAGATGG + Intronic
951481493 3:23166809-23166831 TTGGAGGGTTTCAGGGAGAAAGG - Intergenic
952258535 3:31716443-31716465 CTGGAGGGCCTCGGGGAGCAGGG - Intronic
952258886 3:31720334-31720356 CTTGGGAGATACAGGGAGGAAGG + Intronic
952888944 3:38028740-38028762 CTGGAGGCCTTCTGGGAGGCGGG - Intronic
952946558 3:38481536-38481558 CTGGGGAGGTGCAGGGATGAGGG + Intronic
953118394 3:40015327-40015349 CCTGAGAGCTCCAGGGAGCAAGG + Intronic
953334256 3:42080441-42080463 CTAGAGAGCTGCAGGAAGGCAGG - Intronic
953371586 3:42393104-42393126 CTAGAGCACTTCAGGGAGGAAGG + Intergenic
953906944 3:46873166-46873188 CAGGAAGGCTTCAGAGAGGAGGG + Intronic
953979533 3:47406748-47406770 CGGGTGAGCTACAGCGAGGAGGG + Exonic
954098846 3:48354121-48354143 CTGGCCATATTCAGGGAGGAGGG + Intergenic
954329484 3:49881950-49881972 TTGGATAGCTCCAGGGAGGAAGG - Intergenic
954430234 3:50466941-50466963 CTGGAGGGATTCCTGGAGGAGGG + Intronic
954895321 3:53970261-53970283 CTGGACTGCTCCAGGGAAGATGG - Intergenic
955112526 3:55963055-55963077 CAGAAGAGCTTCAGGATGGAAGG + Intronic
955442426 3:58971443-58971465 CTGGAGAGCATAGGTGAGGAAGG - Intronic
955539543 3:59959941-59959963 ATGTAGAGGTTCATGGAGGAAGG + Intronic
956168809 3:66416754-66416776 CAGAGGAGATTCAGGGAGGATGG - Intronic
956955875 3:74339193-74339215 CTGGACAGCTGGAGGGAGGAGGG - Intronic
956981974 3:74649591-74649613 CTACAGAGCTTCAGGCAGCATGG + Intergenic
957816781 3:85310628-85310650 CTGGAAAGCTAAAGGGAGCATGG + Intronic
958411343 3:93820315-93820337 ATGGAAAGCTTCAAGGAGGAAGG - Intergenic
958440454 3:94150031-94150053 CTGGAGAGGTCCAAGGAGCAAGG + Intergenic
959566118 3:107834635-107834657 CAGGAGAGGTTCTGGGAGGTCGG + Intergenic
960965858 3:123104296-123104318 CTGGAGTTCTTCAGGGCAGAGGG + Intronic
961825761 3:129598263-129598285 CGGGAGGGCTTCCTGGAGGAGGG - Intronic
962407367 3:135111508-135111530 CTAGAAAGCTGCAGGGAGGGGGG + Intronic
963901353 3:150736246-150736268 CTGGAAAGTTTCAAGGAGCATGG - Intergenic
964722722 3:159783323-159783345 CTGAAGAGCTTCTGGGAGCCAGG + Intronic
965700002 3:171450971-171450993 TTGGACAGTTTCAGGGTGGAAGG + Intronic
966646605 3:182252512-182252534 CTGGAGAGGTGGAGGGAGGAAGG + Intergenic
966774660 3:183533379-183533401 CTGGGGAGCCTGAGGGAAGAGGG - Intronic
968088746 3:195886573-195886595 TTAGAGAGGGTCAGGGAGGAGGG + Intronic
968492145 4:895733-895755 TTGGAGAGATGCAGGGATGAGGG + Intronic
968534043 4:1112873-1112895 GTGGGGGGCTGCAGGGAGGAAGG - Intronic
968612439 4:1563416-1563438 CTCTAGGGCTGCAGGGAGGACGG - Intergenic
968977022 4:3827412-3827434 CTGGAACTCTTCAGGGAGGTGGG - Intergenic
969176497 4:5402856-5402878 CAGGAGGGCTTCCTGGAGGAAGG + Intronic
969305958 4:6326454-6326476 AAGGAGAACTTCATGGAGGAGGG + Intronic
969436500 4:7192301-7192323 CTGGAGAGAGGGAGGGAGGACGG + Intergenic
969636906 4:8374596-8374618 CTGGAAGGCTTCCTGGAGGAGGG - Intronic
969671845 4:8594013-8594035 CAGGAGAGCTTCCTGGAGGAGGG - Intronic
969695424 4:8731545-8731567 CTGAAGCCCTCCAGGGAGGAAGG + Intergenic
969862931 4:10051951-10051973 CTGGAGGGCTTTAGGAAGGGTGG - Intronic
969970256 4:11039808-11039830 CTGAAGAGGTCCAGGGATGAGGG - Intergenic
971457773 4:26860676-26860698 GTGGAGAGCCTGAGGGAGGCGGG + Intronic
974382493 4:61159414-61159436 CAGGAGAGAATCAGAGAGGATGG + Intergenic
974482258 4:62460559-62460581 CTAGAGAGAATCAGGGATGAGGG + Intergenic
975105077 4:70558329-70558351 TTGGAAAGTTTCAGGGAGGAAGG + Intergenic
975540649 4:75507178-75507200 CTGGAGACCTACAGGAAAGAAGG + Intronic
975717688 4:77220867-77220889 CTAGAGAACTACAGGAAGGATGG + Intronic
976100029 4:81551398-81551420 CTGTAGATTTTCAGGGAGAAAGG - Intronic
977148693 4:93480890-93480912 CTGTAGAGATTCAGGGAGGTGGG - Intronic
978217433 4:106221803-106221825 CAGGACCGCTTGAGGGAGGAAGG + Intronic
979483262 4:121242300-121242322 CTAGATGGCTTCAGGGAGGGTGG - Intergenic
980829083 4:138107995-138108017 GTGGAAAGCTCCAGGAAGGAGGG - Intergenic
980972081 4:139576339-139576361 CTGGAGAGCTCCAGCAAGGATGG + Intronic
980990283 4:139733649-139733671 CTGAAGACCTACAGGCAGGAAGG + Intronic
982360297 4:154512232-154512254 CTGGAGGGCTGGAGGGAGGATGG + Intergenic
983507531 4:168571171-168571193 CTGGAAAGCTTCTGGGAGAAAGG - Intronic
984624873 4:181995968-181995990 CTGGGGCTCTTGAGGGAGGAAGG - Intergenic
985548220 5:520539-520561 CCGGGGAGATTCCGGGAGGATGG - Intronic
985657961 5:1141991-1142013 CTGCAGGGCTGCAGGGAAGAGGG - Intergenic
987136093 5:14900918-14900940 CTGGAGCCCTTCAGAGAGGAAGG + Intergenic
987444636 5:18002460-18002482 CTGGATAGCCTGAAGGAGGAAGG + Intergenic
989187695 5:38641156-38641178 CCTCAGAGCCTCAGGGAGGAGGG - Intergenic
990310540 5:54533882-54533904 GTGGAGACCAACAGGGAGGAAGG + Intronic
990467168 5:56081397-56081419 AAGGAGAGTTTCAGGGTGGAGGG - Intergenic
991509456 5:67360687-67360709 GGGGAGAGCTTCAAGAAGGAAGG + Intergenic
992789876 5:80203817-80203839 CTAGATAGCTTCAGGATGGAAGG + Intronic
993078567 5:83267632-83267654 CTGGACAGTCTCAGGGAGCAGGG + Intronic
994566301 5:101449931-101449953 CTTGAGAGGTGGAGGGAGGAGGG + Intergenic
995463803 5:112430120-112430142 TGGGAGAGCTTCTTGGAGGAGGG - Intergenic
996449524 5:123603802-123603824 CTAGTGAGCTTCAGAGAAGATGG + Intronic
997452019 5:133991377-133991399 CTGAAGAGTTACAGGGAGGAAGG - Intronic
997606050 5:135176564-135176586 CTGGAGTGCATCATGGAGGCAGG + Intronic
997739367 5:136240141-136240163 TTGGAGAGCTTCACGTAGGAAGG - Intronic
998264839 5:140660048-140660070 CTGTAAAGCTTCAGCCAGGAGGG - Intronic
999942923 5:156563911-156563933 CTGAAGAACTTGAGGGAGTAGGG - Intronic
1000026449 5:157363140-157363162 CTGGAGTGCCTTGGGGAGGAAGG - Intronic
1000335021 5:160235687-160235709 CTGGAGAGCTTCAGGGAGGAGGG - Intronic
1000413998 5:160964469-160964491 GTGGAGAGCTTGAGGGAATATGG - Intergenic
1000706645 5:164521057-164521079 GTGGTGAGGTACAGGGAGGATGG - Intergenic
1001308165 5:170590852-170590874 ATGGGGAGCTTCAGGATGGAAGG - Intronic
1001323555 5:170702490-170702512 GCAGAGAGCTTGAGGGAGGAAGG + Intronic
1002081760 5:176741611-176741633 CTGCAGAGCTTCCTGGTGGATGG - Intergenic
1002105785 5:176878883-176878905 CTGGAGGGCTTCCCTGAGGAGGG + Intronic
1002152927 5:177250754-177250776 CAGGACAGCTTTAGGGAGAAAGG - Intronic
1002312607 5:178323726-178323748 CTGGAACGCTGCAGGGAGCAGGG + Intronic
1002338727 5:178500061-178500083 GTGGGGAGGTACAGGGAGGAAGG + Intronic
1003098894 6:3162547-3162569 CAGAAGAGCTCCAGGGAGGGAGG - Intergenic
1003497347 6:6675901-6675923 CTGGAAAGGCTGAGGGAGGAGGG + Intergenic
1004143650 6:13045048-13045070 TAGGAGGGCTTCAGGGATGAGGG - Intronic
1005604923 6:27467168-27467190 TAGGAGAGTTTCATGGAGGATGG - Intronic
1005675336 6:28148709-28148731 CTGGAGCTCCTCAGGTAGGATGG - Exonic
1005700719 6:28398097-28398119 CTGGAGCTCCTCAGGTAGGATGG + Exonic
1005719370 6:28586391-28586413 CTGGAGCTCCTCAGGCAGGATGG + Exonic
1005872043 6:29981721-29981743 CTGGAAAGCATCAGAGAGGAGGG + Intergenic
1006393435 6:33772162-33772184 CTTGAGAGCTCCAGGGTGAAGGG - Exonic
1006798880 6:36747008-36747030 CTGGCGAGTGACAGGGAGGAGGG - Intronic
1006947039 6:37791540-37791562 GTGCAGAGTTACAGGGAGGAGGG + Intergenic
1007281238 6:40713879-40713901 CTGGAGACCTGCAGGAGGGAAGG + Intergenic
1007487868 6:42194828-42194850 CTGAGGAGCATCAGGGAGCAAGG + Exonic
1008624096 6:53300883-53300905 CAGGAGGGCTGCAGGAAGGAGGG - Intronic
1008904482 6:56661438-56661460 CTGTAAAGCTTGAGGGAAGATGG - Intronic
1009317792 6:62243789-62243811 CTGCAGAGCTGCTGAGAGGATGG + Intronic
1012462697 6:99481655-99481677 TGGGAGAGATTGAGGGAGGAAGG - Intronic
1014228999 6:118881321-118881343 ATGGAAAGTTTCAAGGAGGAAGG - Intronic
1015705247 6:136080857-136080879 ATGGAGAGCTGCATGGAGGAAGG + Intronic
1015791359 6:136967569-136967591 CTGGAGATCTCCAGGCTGGATGG - Intergenic
1015927425 6:138324050-138324072 ACGGAGAGCTTCAGCGGGGAAGG + Exonic
1017025753 6:150179091-150179113 CTGGGGAGACCCAGGGAGGAAGG + Intronic
1017169337 6:151441482-151441504 CTGGACAGCTTCAGGATGGGGGG + Intronic
1017597396 6:156044271-156044293 CAGGAGGGCTTCAGGAAGAAAGG - Intergenic
1018373332 6:163187861-163187883 GTGAAGAGCTCCAGGGAGGCCGG + Intronic
1019374381 7:681577-681599 CTGGAGGTCTGCTGGGAGGAGGG + Intronic
1022247272 7:28572578-28572600 CAGGAGAACTCCAGGGGGGAAGG - Intronic
1022941854 7:35249369-35249391 CTGCAGGGCTGCAGGGAGGTTGG - Intronic
1023416224 7:39935508-39935530 TTGCAGAGGTTCAGGGAGGAAGG - Intergenic
1023659422 7:42457226-42457248 CTGGGTGGCTTCAGGAAGGAAGG + Intergenic
1023852647 7:44158852-44158874 CTGGATAGCCACAGTGAGGAGGG + Intronic
1023874243 7:44278155-44278177 CAGGACAGCTTCATGGAGGAGGG + Intronic
1024011106 7:45267443-45267465 CTGGACAGCTCCAGGGTGTAGGG + Intergenic
1024125477 7:46290508-46290530 CTGGGAAGCTTTAGAGAGGAGGG + Intergenic
1024534167 7:50416464-50416486 TTGGGGAGCTCCAGGGAGCAAGG - Intergenic
1027724840 7:81791036-81791058 CTGGGAATCTTCAGGGAAGAGGG - Intergenic
1028331938 7:89605470-89605492 CCAGAGACCTTCAGAGAGGATGG - Intergenic
1028378827 7:90176074-90176096 CTGCAGAGCCTCAGAGAGGGTGG + Intronic
1029291677 7:99506343-99506365 CTGGAACTCTTCAGGCAGGATGG - Exonic
1029588811 7:101493382-101493404 CAGGAGGGCTTCATGGAGGCGGG - Intronic
1030360253 7:108588037-108588059 ATGGAGAGTGTGAGGGAGGAGGG - Intergenic
1030613254 7:111711626-111711648 CTGAACAGCTTCAGGGAGTGTGG + Intergenic
1030956928 7:115864493-115864515 CTGGAGAGAATCAAGGTGGATGG - Intergenic
1031192771 7:118575802-118575824 CTGGGAAGTTTCAGGAAGGAAGG + Intergenic
1031893839 7:127325085-127325107 CTGGAGACCTTAATGGTGGAAGG + Intergenic
1033609851 7:142954544-142954566 CTGGAGAGAAGCAGGGAGCATGG + Intronic
1034060461 7:148082580-148082602 AGAGAGAGCTTCAGGGAGGTGGG + Intronic
1034106132 7:148491362-148491384 CTGTAGAGCTTCAGCCAGTAAGG - Intergenic
1034129432 7:148701343-148701365 CTGGGGTGTTTCAGGGAGAAGGG - Intronic
1034536325 7:151728038-151728060 CTGGAGGGATCCACGGAGGACGG - Intronic
1035140261 7:156752572-156752594 GAGGGGAGCTGCAGGGAGGAGGG + Intronic
1035409007 7:158623512-158623534 GTGGTGAGCCTCAGTGAGGAGGG - Intergenic
1036769233 8:11567237-11567259 CTGGAGATCTTGAAGGATGAGGG + Intergenic
1036811614 8:11870742-11870764 CAGGAAAGCTTCATGGAGAAAGG + Intergenic
1036962828 8:13264567-13264589 CTGGAGAACTTCAGGGGGAGCGG + Intronic
1037380372 8:18278582-18278604 CTGGAGATCTTGAAGAAGGAGGG - Intergenic
1037424585 8:18741721-18741743 CTGGAGAGCTTAAAGTAGGTGGG - Intronic
1037504161 8:19514254-19514276 CTGGAGGGGGTCAGGGAAGAAGG - Intronic
1037573092 8:20175211-20175233 ATGGAGATGTTCAGGGAGCAAGG - Intronic
1037763949 8:21760225-21760247 CTGGAGAGCATTAAGGAGGAAGG + Intronic
1037988141 8:23302376-23302398 AGGGAGGGCTTCATGGAGGAAGG - Intronic
1038012197 8:23483967-23483989 CTGGAGATCTTCAGGAAGATAGG + Intergenic
1038330481 8:26604426-26604448 CTGGAAGGCTTCCTGGAGGAGGG + Intronic
1038957391 8:32482550-32482572 TTGGACAGCTTCAGGGAAGCAGG - Intronic
1041070620 8:54124613-54124635 AAGGAGAGTTTCAGGGTGGAGGG - Intergenic
1041800472 8:61792460-61792482 CTGGAGTGTTTCAGGGAAAAAGG + Intergenic
1042051227 8:64710210-64710232 ATTGAGAGTTTCAGAGAGGATGG - Intronic
1042376753 8:68061066-68061088 TGGGAGTGCTTCATGGAGGACGG + Intronic
1042787069 8:72559546-72559568 CTGGAGAGATCCAGGGCAGAAGG + Intronic
1044818984 8:96143424-96143446 ATGGTGGGCCTCAGGGAGGATGG - Exonic
1044831700 8:96256188-96256210 CTGGATAGCTTAAGGGAGCCAGG - Intronic
1045039868 8:98213201-98213223 CTGGGGAGGTTGAAGGAGGAGGG - Intronic
1045412708 8:101934569-101934591 GTCGGGAGCTTCAGGAAGGAGGG + Intronic
1046942752 8:119946899-119946921 CTGGAGAGGGTGAGGGAAGAAGG - Intronic
1047358512 8:124145766-124145788 CTGGAGAGCTGGTGGGAGGCTGG - Intergenic
1047526555 8:125638813-125638835 AGGCAGGGCTTCAGGGAGGAGGG + Intergenic
1047715533 8:127591636-127591658 CTGGAGGACCTCAGGGAGGAGGG + Intergenic
1047768745 8:128013067-128013089 CAGGATGGCTTCAGGGAAGAAGG - Intergenic
1047803122 8:128330781-128330803 CTGGGGAGCTTGAGAGCGGATGG - Intergenic
1048255480 8:132901895-132901917 CTGAAGTGCCTCAGTGAGGATGG - Intronic
1048488230 8:134868215-134868237 ATGGAGAGCTTGAGAGGGGAAGG + Intergenic
1049414715 8:142489946-142489968 CTGGAGAGCTCCAAGGAGCAGGG - Intronic
1050099186 9:2100086-2100108 CTGCAGGGATCCAGGGAGGAGGG + Intronic
1050106006 9:2167582-2167604 CTGAAGAGTGTCAGGGAGGCAGG - Intronic
1050406151 9:5310366-5310388 GGGGAGAGGTACAGGGAGGAAGG - Intergenic
1051936234 9:22446697-22446719 GTGGGGACCTTCTGGGAGGAGGG - Intergenic
1053142733 9:35691137-35691159 GTGGAGAGCCGCCGGGAGGAGGG + Intergenic
1053365797 9:37521673-37521695 CAAGAGAACTTCAGCGAGGATGG - Exonic
1053790457 9:41682901-41682923 CTGGAGATGTCCAGGGATGAAGG - Intergenic
1054178802 9:61894600-61894622 CTGGAGATGTCCAGGGATGAAGG - Intergenic
1054658735 9:67686231-67686253 CTGGAGATGTCCAGGGATGAAGG + Intergenic
1055719483 9:79155895-79155917 CTGGGGAGGTTTAGAGAGGATGG - Intergenic
1055791922 9:79931580-79931602 CTGGAGAGAGGCAGGGTGGAGGG + Intergenic
1057171153 9:92963975-92963997 GTGTAGATCTTCAGGGAGGAGGG - Intronic
1057211085 9:93201487-93201509 CTGTAGAGCTTGTGGGAGCAGGG + Intronic
1057220955 9:93257460-93257482 CTGGGGTCCTTCAGGGAGGGCGG + Intronic
1057385012 9:94599208-94599230 CTGTTGAGCCTCAGAGAGGAGGG - Intergenic
1057714821 9:97484272-97484294 CTGCAGGGCTTTGGGGAGGAGGG - Intronic
1057775635 9:98006491-98006513 CTGGAGAGCTTCTTTGAGAAGGG + Intronic
1058869830 9:109192084-109192106 CTAGAGCCCTTGAGGGAGGAAGG - Intronic
1059182138 9:112226283-112226305 CTGGAGACCAGCAGGGAGGCCGG + Intronic
1059437084 9:114283525-114283547 GTGGGGAACTCCAGGGAGGAGGG + Intronic
1059540538 9:115125941-115125963 CTGGGAAGGTTCTGGGAGGAGGG + Intergenic
1060202300 9:121658408-121658430 CTTGACAGTTGCAGGGAGGAGGG + Intronic
1060218525 9:121752524-121752546 CAGGAAGGCTTCAGGGAAGAAGG + Intronic
1060775082 9:126367223-126367245 CTGGAGAGCCCCGGGCAGGAAGG - Intronic
1060781849 9:126418816-126418838 CTGGAAGGCTTCCTGGAGGAAGG - Intronic
1060934822 9:127508750-127508772 AAGGAGAGCTTCCTGGAGGAAGG + Intronic
1061046399 9:128167382-128167404 CAGGAGGGCTTCCTGGAGGAGGG - Intronic
1061080188 9:128365230-128365252 CCTGCGAGCTTCAGAGAGGACGG + Intergenic
1061404492 9:130385822-130385844 CTGGCGAGCTGCGGGGAGGAAGG + Intronic
1062151092 9:135019432-135019454 CAGGAGAGCTCCAGGGAAGACGG + Intergenic
1062165665 9:135106096-135106118 CTGGAGCGCACCAGGGCGGATGG - Intronic
1062340356 9:136091307-136091329 CAGGACGGCCTCAGGGAGGACGG + Intronic
1203633446 Un_KI270750v1:91257-91279 ATAGAGAGATTCTGGGAGGAGGG + Intergenic
1203634001 Un_KI270750v1:94891-94913 CTGGGGATCTGCAGGGAGGTCGG + Intergenic
1186500401 X:10046084-10046106 CTGGAGAGGCTCAGTGTGGATGG + Intronic
1186557878 X:10579756-10579778 CTGCAGAGCTTCAGTGATCAGGG - Intronic
1189417842 X:40830828-40830850 CTTGACAGCTTTAGTGAGGAGGG - Intergenic
1189635879 X:43008641-43008663 CTGGCCTGCTTCAGGGAAGAAGG + Intergenic
1192235009 X:69290017-69290039 CTGCAGAGCCTCTGGGAGGCAGG + Intergenic
1193519541 X:82512080-82512102 CGTGAAAGCTTCAGGGAGGCAGG - Intergenic
1195393148 X:104384058-104384080 CTGGAGAGCCTTAGTCAGGAAGG + Intergenic
1198231439 X:134693231-134693253 CTGGAGAGCTGGAGGCAGGAAGG - Intronic
1199070151 X:143467012-143467034 CTAGAGTGCCTCAGGGGGGACGG + Intergenic
1199086621 X:143635582-143635604 CTGGAGAGCCTGGGGGAGGGGGG + Intronic
1199714868 X:150500318-150500340 CTGGAGAGCTCCAAGGAGATTGG + Intronic
1199966300 X:152823787-152823809 CTGGAGAGCTGCAGGAGGGTGGG - Intergenic
1200129520 X:153833349-153833371 TGGGAGAGCGTCCGGGAGGAAGG + Intergenic
1200158723 X:153993176-153993198 ATGGAGAGCTTCAAGCAGCAGGG - Intergenic
1200337061 X:155361986-155362008 CTGGAGAGTTTTAGGGAGAGTGG + Intergenic
1200349409 X:155479241-155479263 CTGGAGAGTTTTAGGGAGAGTGG - Intergenic