ID: 1000335388

View in Genome Browser
Species Human (GRCh38)
Location 5:160238115-160238137
Sequence TAGTGGGAGAGGCAGGCGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 634
Summary {0: 1, 1: 0, 2: 0, 3: 42, 4: 591}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000335388_1000335400 2 Left 1000335388 5:160238115-160238137 CCCCCCGCCTGCCTCTCCCACTA 0: 1
1: 0
2: 0
3: 42
4: 591
Right 1000335400 5:160238140-160238162 CCTTAGGCTTCTCGAGAGTAGGG 0: 1
1: 0
2: 0
3: 6
4: 79
1000335388_1000335398 1 Left 1000335388 5:160238115-160238137 CCCCCCGCCTGCCTCTCCCACTA 0: 1
1: 0
2: 0
3: 42
4: 591
Right 1000335398 5:160238139-160238161 ACCTTAGGCTTCTCGAGAGTAGG 0: 1
1: 0
2: 0
3: 6
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000335388 Original CRISPR TAGTGGGAGAGGCAGGCGGG GGG (reversed) Intronic
900154945 1:1200208-1200230 GAGGGGGAGAGGGAGGTGGGGGG - Intergenic
900243984 1:1629380-1629402 TGCAGGGAGCGGCAGGCGGGCGG + Exonic
900706346 1:4082505-4082527 TACTGGGGGAGGGAGGCTGGGGG + Intergenic
901035092 1:6331693-6331715 TAATGGGAAGGGCAGGCTGGTGG - Intronic
901162337 1:7188182-7188204 TTGTGGGAGAGACTGGTGGGAGG - Intronic
901619160 1:10568326-10568348 TAGTGGGAGTGGGGGGGGGGGGG - Intronic
901622285 1:10598211-10598233 GAGTGGGAAAAGCAGGTGGGAGG - Intronic
901638702 1:10682327-10682349 AAGTGGGAGAGGCAGAGGGCAGG + Intronic
901794563 1:11672916-11672938 CAGTGGGAGAGTCAAGGGGGTGG - Intronic
901821467 1:11832938-11832960 TAGAAGGAGAGGCAGCCTGGAGG + Intronic
901954662 1:12775441-12775463 GAGTGGGAGAAGCAGCAGGGAGG + Intronic
902040088 1:13486201-13486223 CAGAGGGAGAGGCTGGAGGGAGG - Intronic
902118367 1:14140701-14140723 TCGTGGGGGAGGCAGGGGTGCGG - Intergenic
902130383 1:14255190-14255212 TAGTGAGAGAGGGAGTTGGGGGG + Intergenic
902361315 1:15943948-15943970 TTGTGGGAGGGGCAGGTGAGGGG - Intronic
902624149 1:17667007-17667029 TACTGGGAGAGGCAGGCCAAGGG - Intronic
902667893 1:17952364-17952386 GAGAGGGAGAGGCTGGCGGATGG + Intergenic
902917510 1:19647559-19647581 AGGTGGGAGAGGCAGGGGAGGGG + Intronic
903741619 1:25561893-25561915 TAGTGCCAGAGGGAGGTGGGTGG + Intronic
903921821 1:26804913-26804935 GAGAGGGAGAGGGAGACGGGAGG + Intergenic
903950096 1:26991627-26991649 GGCTGGGAGAGGAAGGCGGGTGG - Intergenic
904013927 1:27406120-27406142 TAGTTGGAGAGGCAGGCAGAGGG - Exonic
904284183 1:29443498-29443520 TAGTGGAAGAAGGAGGTGGGAGG + Intergenic
904912282 1:33944360-33944382 TACTGGAAGAGACAGGCAGGTGG + Intronic
905033924 1:34905021-34905043 GAGTGTAGGAGGCAGGCGGGGGG + Exonic
905037015 1:34925131-34925153 CAGTGGGAGGGGCAGGGGAGAGG - Intronic
905315418 1:37079748-37079770 GAGAGGGAGAGGGAGGCGGAGGG - Intergenic
906948684 1:50316922-50316944 TGGTGGCAGGGGCTGGCGGGGGG + Intergenic
907270646 1:53288959-53288981 TGGTAGCAGAGGCAGGCAGGGGG - Intronic
907497529 1:54854801-54854823 AATTGGGGGAGCCAGGCGGGTGG - Intronic
907555215 1:55337377-55337399 TGGTGGCAGAGGCAGGGGTGTGG + Intergenic
907768677 1:57437926-57437948 TAGTGGCAGAGGCAGAGCGGGGG - Intronic
908224682 1:62044276-62044298 TAGTGGGAGGGGCTGGTGGATGG - Intronic
909954636 1:81763761-81763783 CTGTGGGAGACGGAGGCGGGCGG + Intronic
910452743 1:87363684-87363706 TAGTGTGAGAGACAGGCTGCTGG - Intergenic
910607300 1:89100657-89100679 TAGTGAGACAGCCAGGTGGGAGG - Intergenic
910688406 1:89941182-89941204 TAGTGGGAGAGGCAGGAATTGGG + Intergenic
911406681 1:97449427-97449449 AAGTGGGAGAGGGAGGTGGGAGG + Intronic
912433726 1:109643809-109643831 GCGCGGGAGAGGCAGGCGGAGGG + Intergenic
912445485 1:109732912-109732934 AAGTGGCAGATGCAGGGGGGTGG - Intronic
913046778 1:115080390-115080412 TAGTGGGAGGAGGAGGTGGGAGG - Intronic
913480101 1:119280061-119280083 TGGTGGGAGAGGAAGGCCAGGGG - Intergenic
913532701 1:119743889-119743911 TCCTGGCAGAGGCAGGCGTGCGG + Exonic
913565168 1:120066452-120066474 TAATGGGAGAGGTAGGGAGGAGG + Intronic
913632960 1:120727107-120727129 TAATGGGAGAGGTAGGGAGGAGG - Intergenic
914285758 1:146225809-146225831 TAATGGGAGAGGTAGGGAGGAGG + Intronic
914546790 1:148676561-148676583 TAATGGGAGAGGTAGGGAGGAGG + Intronic
914619774 1:149394107-149394129 TAATGGGAGAGGTAGGGAGGAGG - Intergenic
914951863 1:152122900-152122922 TCCTGGGAGACCCAGGCGGGTGG + Intergenic
915083182 1:153366021-153366043 TTGGGGGAGAGGCAGGGGAGAGG - Intergenic
915801186 1:158795010-158795032 TAGGGGCAAAGCCAGGCGGGGGG + Intergenic
916021080 1:160793059-160793081 TATTGGGAGGCGGAGGCGGGCGG - Intergenic
917925879 1:179788843-179788865 TGGTGAGTGAGGCAGGCTGGAGG - Intronic
918056366 1:181025156-181025178 TGGTGGGAGAGACAGACTGGTGG + Intergenic
919078009 1:192836015-192836037 AAGAGGGGAAGGCAGGCGGGTGG + Intergenic
919465082 1:197916408-197916430 TAGTGGGAGAAGCACGCGATGGG + Intronic
919518028 1:198551027-198551049 TAGTGGGAGAAGGAGGAGGAAGG + Intergenic
920035825 1:203064806-203064828 AAGTGAGAGAAGCAGGCTGGGGG - Intronic
920798304 1:209161801-209161823 TAATGGGAGAGGCAGCCAGTCGG - Intergenic
920947355 1:210542216-210542238 AGGTGGGAGAGGCAGGCAGATGG - Intronic
921278364 1:213541714-213541736 TAGTGGGAGAGACAGCTGTGTGG + Intergenic
922416149 1:225425211-225425233 TAGTGGGAGAGTGGGGGGGGAGG + Intronic
922496530 1:226062317-226062339 TGGGGGGAGGGGAAGGCGGGCGG - Intronic
922593321 1:226795413-226795435 GAGAGGGAGAGGCAGGAAGGAGG - Intergenic
922630265 1:227100268-227100290 AAGTGGGAGGAGCAGGCTGGAGG - Intronic
923174720 1:231453558-231453580 AAGTGGGAGAGGGAGGGGGAGGG - Intergenic
923420975 1:233814625-233814647 TACTGGGAGAGGGAAGCTGGAGG + Intergenic
924557563 1:245130793-245130815 TAGCTGGAGAGGCAGGGGCGAGG - Intergenic
924581916 1:245330599-245330621 GAGTGGGGGAGGGAGGAGGGAGG + Intronic
1062974399 10:1672704-1672726 GCGTGGAGGAGGCAGGCGGGGGG - Intronic
1064680821 10:17809375-17809397 TAGGTGGAGAGGCAGTTGGGGGG + Exonic
1065099705 10:22321191-22321213 CTGTGGGGGAGGCGGGCGGGCGG - Exonic
1067046443 10:42988027-42988049 CAGTGGGAGAGGCAGTCAGCTGG - Intergenic
1067817731 10:49495320-49495342 GTGTGTGAGAGGCAGGCGTGTGG - Intronic
1068726953 10:60313877-60313899 TAATGGGTGATGCAGGCTGGAGG - Intronic
1068815493 10:61305735-61305757 TAGTGAGAGAGGGAGGCATGTGG + Intergenic
1069449620 10:68505789-68505811 TTTTGGGAGACGGAGGCGGGTGG + Intronic
1069567041 10:69470556-69470578 GACTGGGAGATGCAGGTGGGAGG - Intronic
1069890444 10:71649103-71649125 GACTGGGAGAGGAAGGGGGGAGG - Intronic
1070295317 10:75155965-75155987 TTTTGGGAGACCCAGGCGGGAGG + Intronic
1070622558 10:78024492-78024514 GTGCGGAAGAGGCAGGCGGGAGG + Intronic
1070781138 10:79138054-79138076 CAGCGGGAGGGGCAGGCGGCGGG + Intronic
1071315527 10:84392186-84392208 TACTGGAAGGGGCAGGAGGGAGG + Intronic
1071328255 10:84537554-84537576 TAGTGGGGAGGGCCGGCGGGAGG + Intergenic
1072383745 10:94902022-94902044 TAGTGGGAGAGGAAGGTAGGAGG + Intergenic
1072961680 10:99934853-99934875 CTGTGGGAGACTCAGGCGGGTGG + Intronic
1072964648 10:99961503-99961525 CTGTGGGAGACTCAGGCGGGTGG - Intronic
1073378308 10:103056353-103056375 GAGTGGGAGAGGGAGACGTGGGG + Intronic
1074208456 10:111305177-111305199 TTGGGGGAGGGGCAGGTGGGAGG + Intergenic
1074423257 10:113328057-113328079 AAGGGGGAGAGGAAGGTGGGAGG - Intergenic
1074491417 10:113942556-113942578 CAGTGGGAGTGGGAGGTGGGAGG - Intergenic
1074533460 10:114312419-114312441 TAGTGGGTGAGGCAGGAGACTGG + Intronic
1074983240 10:118636146-118636168 TAGTGGGAGAGGCAGACAGCAGG - Intergenic
1075132425 10:119751463-119751485 AAGCTGGAGAGGCAGGCAGGTGG + Intronic
1075241184 10:120780549-120780571 CAGTGGGAGAGGCAGTCGGAGGG - Intergenic
1075654534 10:124152471-124152493 GAGTGGGAGGGGCAGACTGGAGG - Intergenic
1076191924 10:128489237-128489259 TTGTGGGAGAGGCTGGGGTGGGG + Intergenic
1076238592 10:128884649-128884671 TCCTGGGAGAGGGAGGTGGGAGG - Intergenic
1076326319 10:129626268-129626290 GAGAAGGAGAGGCATGCGGGTGG - Intronic
1076602729 10:131669491-131669513 GAGAGGGAGAGCAAGGCGGGGGG + Intergenic
1076815620 10:132913362-132913384 AAGTGGGAGGGGCGGGTGGGCGG + Intronic
1076858326 10:133128075-133128097 TAGAGGCAGAGCCAGGCAGGGGG - Intronic
1077036407 11:497004-497026 TACTGGGAAAGGCGGGCTGGCGG - Intronic
1077037375 11:502007-502029 TGGTGGGGCAGGCTGGCGGGTGG - Intronic
1077321051 11:1942122-1942144 GAGTGGGGGAGGAAGGTGGGAGG + Intergenic
1078241436 11:9534300-9534322 AAGTGGGAAAAGCAGGCTGGAGG - Intergenic
1078660430 11:13281335-13281357 GAGTGGGGGAGGCTGGCAGGAGG - Intronic
1079116148 11:17641785-17641807 CAGTGGGAGAGCCAGGGTGGAGG + Intronic
1079424884 11:20330650-20330672 TAGAGGGAGAGGCAGGTGGAAGG - Intergenic
1079645912 11:22863644-22863666 TAGTGGCGGAGGGAGGTGGGGGG + Intergenic
1080037358 11:27722884-27722906 TAGAGGGGGAGGCGGGAGGGGGG + Intergenic
1080438960 11:32272795-32272817 TAGTGGGAGGGTCAGGAGGGAGG + Intergenic
1081631691 11:44693979-44694001 TGATGGGAGAAGCAGACGGGCGG - Intergenic
1081808605 11:45903082-45903104 TCCTCGGAGAGGCAGGCAGGGGG - Exonic
1082819847 11:57537506-57537528 AAGAGGGAGAGGAAGGGGGGAGG + Intergenic
1083221455 11:61255527-61255549 TATTTGCAGAGGCAGGTGGGGGG + Intergenic
1083490346 11:63010930-63010952 TGGCGGGAGAGACAGACGGGAGG - Intronic
1083592867 11:63905460-63905482 TAGTGGGAGAGGCAGTCAAAGGG - Intronic
1083777579 11:64901838-64901860 TGGTGAGAGAAGCAGGCAGGAGG - Intronic
1084209245 11:67613424-67613446 AACTGGGGTAGGCAGGCGGGAGG - Intergenic
1084529304 11:69717585-69717607 TACAGGGAGAGGCAGGAAGGAGG - Intergenic
1084574700 11:69981660-69981682 TAGCGGGAGAGGAGGGCTGGAGG - Intergenic
1084594203 11:70107434-70107456 AAGTGAGAGAGGCAGCCAGGGGG + Intronic
1084925525 11:72508298-72508320 TAGTGAGACAGCCAGGTGGGAGG - Intergenic
1085079388 11:73621485-73621507 TTTTGGGAGACCCAGGCGGGTGG + Intergenic
1085388740 11:76171531-76171553 CAGTGGGGATGGCAGGCGGGAGG + Intergenic
1085390761 11:76180975-76180997 GAGTGGGAGCAGCAGGCAGGAGG - Intergenic
1085745690 11:79112493-79112515 TAGGGTGAGAGGTAGGTGGGTGG + Intronic
1085755157 11:79195930-79195952 TTGTGGGAGAGACCAGCGGGAGG + Intronic
1085759973 11:79233433-79233455 TTGTGGAAGAGGCAGGGGGACGG + Intronic
1086078145 11:82876524-82876546 TTGTGGGAGAGACCGGGGGGAGG + Intronic
1088469190 11:110175987-110176009 CAGTGGGAGAGGCGGGAGTGGGG + Intronic
1089254506 11:117187181-117187203 CCATGGGAGAGGCAGGCAGGGGG + Intronic
1089292128 11:117443737-117443759 GTGTGCGGGAGGCAGGCGGGTGG + Intronic
1089681694 11:120122245-120122267 ATGTGGGAGAGGGAGGCTGGGGG - Intronic
1089730050 11:120513684-120513706 GAGCTGGTGAGGCAGGCGGGAGG - Intronic
1090833512 11:130437047-130437069 TGGTGGGAGAGGAAGGGGGGAGG + Intergenic
1091090332 11:132764947-132764969 CAGTGTCAGAGGCAGGCGTGAGG - Intronic
1091166174 11:133478235-133478257 TGCTGGGAGAGGCAGGCAGGAGG - Intronic
1091306356 11:134538790-134538812 CAGGGGGAGAGGCAGGCTGGAGG + Intergenic
1091715832 12:2775539-2775561 TGGTGGGTGCGGCAGGCCGGAGG - Intergenic
1092288108 12:7141564-7141586 TAGTGGGAGATACGGGAGGGAGG - Intronic
1092630708 12:10372869-10372891 TGGTGGGAGAGGCAGCCTTGGGG + Exonic
1093728455 12:22542305-22542327 AAGCGGGAGAGGCAGGAGGATGG + Intronic
1094066974 12:26371686-26371708 TAGTGAGAGAGGCAGGTACGGGG + Intronic
1094793048 12:33936403-33936425 TTGTGGGGGGGGCAGGGGGGAGG + Intergenic
1095157739 12:38879108-38879130 TATTGAGAGAGTCAGGTGGGAGG + Intronic
1095528527 12:43157265-43157287 TAGTTGGGGAGGCAGTAGGGCGG + Intergenic
1096031300 12:48417727-48417749 TAGAGGGAGAGGGAGGGAGGGGG - Intergenic
1096259383 12:50081434-50081456 TGGTGGCAGAGGCGGGTGGGCGG - Intronic
1096352180 12:50909572-50909594 TAGTTGGGGAGGGAGTCGGGGGG + Intergenic
1097019132 12:56007657-56007679 TTGGGGGAGAGGGAGGCGAGGGG - Exonic
1097241350 12:57577644-57577666 TAGAGGAAGAGGCAGGAGGAAGG + Intronic
1097686239 12:62693736-62693758 TAGTGGGGGTGGGAGGTGGGCGG - Intronic
1097691986 12:62742068-62742090 TAGTGGGCAAGGCAGGGAGGGGG + Intronic
1098876539 12:75871858-75871880 CAGTGGGAGTGGGAGGAGGGAGG - Intergenic
1101093640 12:101313726-101313748 GAGTGGGACAGGAAGGAGGGAGG + Intronic
1101131794 12:101697772-101697794 TGGAGGGAGAGGCTGGCGGCCGG - Exonic
1101479623 12:105084469-105084491 CAGCGCGGGAGGCAGGCGGGCGG + Exonic
1102349291 12:112180182-112180204 GGGTGGGAGAGGCAGGTGTGTGG + Intronic
1102599329 12:114017281-114017303 TTGTGGGAGGGGGAGGAGGGAGG + Intergenic
1102699781 12:114829128-114829150 TAGTGGGAGAGAAAGAAGGGAGG - Intergenic
1104108269 12:125683824-125683846 CAGTGGGCGAGGCTGGAGGGAGG - Intergenic
1104360941 12:128132612-128132634 TCGTGGGAGAGGCAGACCTGTGG + Intergenic
1104437481 12:128767369-128767391 GAGGGAGAGAGGCAGGCAGGGGG + Intergenic
1105437579 13:20391226-20391248 TAGGGGGAAAGGGAGGCGGGGGG + Intergenic
1105446585 13:20462225-20462247 TGGTGGGAGAAGGAGGCAGGAGG + Intronic
1105619613 13:22053972-22053994 TAGTGGGAGGGGGAGGGGGGTGG + Intergenic
1105814386 13:24021159-24021181 TATTAGGAGAGGCAGGAGAGAGG + Intronic
1106199946 13:27527835-27527857 GGGTGGCAGAGGCAGGCAGGTGG - Intergenic
1106593388 13:31116937-31116959 CAGAGGGAGAGGGAGGAGGGAGG + Intergenic
1107781755 13:43910839-43910861 TAGTGGGAGGCCGAGGCGGGCGG - Intergenic
1108259724 13:48644487-48644509 TAGTGGTAGAGAGAGGCAGGAGG - Intergenic
1109548535 13:63860798-63860820 CAGTGGGAGGGGTAGGTGGGTGG - Intergenic
1110031421 13:70619250-70619272 TGAAGGGAGAGGCAGGCAGGGGG + Intergenic
1110909606 13:80939902-80939924 CAGTGGGCCAGGCAGGTGGGTGG + Intergenic
1113243741 13:108370373-108370395 TATTGGGAGAGGCAGAAGTGGGG - Intergenic
1113702711 13:112399215-112399237 TAATGGGAGAGGTAGGAGGCAGG + Intronic
1114259112 14:21025005-21025027 TAGGGGGAGGGGCAGGCGAGGGG - Intronic
1114387189 14:22267530-22267552 TAGTGAGACAGCCAGGTGGGAGG - Intergenic
1115428383 14:33287602-33287624 TAGTAGGAGAGGGATGCAGGTGG - Intronic
1116783732 14:49265965-49265987 TCGTGGGAGGGGTAGGTGGGAGG + Intergenic
1118585882 14:67352686-67352708 AGGTAAGAGAGGCAGGCGGGGGG + Intronic
1119186324 14:72645428-72645450 TACTGGGGGAGGCAGGTAGGGGG - Intronic
1120141211 14:80931978-80932000 TCGTGGGAGAGACTGGTGGGAGG + Intronic
1120610582 14:86636457-86636479 GAGAGGGAGAGGCGGGGGGGGGG + Intergenic
1121097676 14:91229175-91229197 TACAGGGAGAGGCAGGCCTGTGG + Intergenic
1121571260 14:94948326-94948348 TAGTGGGAGCTGTAGGCAGGGGG - Intergenic
1121733573 14:96202927-96202949 TAGGTGGATAGGCAGGTGGGCGG + Intergenic
1122119626 14:99545196-99545218 GTGTGGGAGAGGCAGGCAGCCGG - Intronic
1122661746 14:103300677-103300699 TAATGGGAGAAGCAGGCATGTGG - Intergenic
1122758882 14:104005502-104005524 TAGCGGGAAAGTGAGGCGGGAGG - Intronic
1122924945 14:104895163-104895185 TAGGGGGCGAGGCAGGGGTGGGG - Exonic
1123020225 14:105394476-105394498 TGGTGGGCCAGGCAGGCAGGTGG + Intronic
1123439890 15:20282540-20282562 CACTGGGAGATGCAGGCAGGGGG + Intergenic
1123697471 15:22889632-22889654 AAGCGAGGGAGGCAGGCGGGGGG - Intronic
1125106057 15:35972713-35972735 TAGTCGGAAAGGCAGGAGAGTGG + Intergenic
1125637696 15:41203256-41203278 CAGTGGGAGAGGAATGGGGGAGG - Intronic
1126426666 15:48534993-48535015 TGGTGGGAGAGATAGGAGGGTGG - Intronic
1127047522 15:55043016-55043038 TGGTGGGTGGGGCAGGAGGGTGG + Intergenic
1127470100 15:59282871-59282893 GAGTGGGAGAGGGAGGGGAGGGG + Intronic
1128413656 15:67423657-67423679 TTTTGGGAGGCGCAGGCGGGTGG + Intronic
1128624766 15:69188953-69188975 AAGTGGGAAAGGCTGGTGGGGGG - Intronic
1128661902 15:69507532-69507554 GAGAGGGAGAGCGAGGCGGGTGG - Intergenic
1129263832 15:74383466-74383488 TCTTGGGAGAGGCAGGTGCGTGG - Intergenic
1129325683 15:74799096-74799118 TGGGGGCAGAGGCAGGAGGGTGG + Intronic
1129731564 15:77935403-77935425 TGGTGGAAGGGGCAGGTGGGAGG + Intergenic
1130324607 15:82869699-82869721 TTTTGGGAGACCCAGGCGGGTGG - Intronic
1130856039 15:87840888-87840910 GAGGGGGAGAGGGAGGAGGGAGG + Intergenic
1131486621 15:92826082-92826104 AAGTGGGAGAGGAAGACAGGAGG + Intergenic
1132803153 16:1763886-1763908 GGGTGGGAGAGGACGGCGGGTGG + Intronic
1132954982 16:2586862-2586884 TTGTTGGAGAAGCAGGCTGGCGG + Exonic
1133558109 16:6924823-6924845 TAGGGGGAGGGGGAGGGGGGAGG - Intronic
1134122801 16:11596696-11596718 CAGGGGGAGAGGGAGGAGGGGGG + Intronic
1134203167 16:12215599-12215621 CAGTGGAACAGGCAGGCAGGTGG + Intronic
1134449218 16:14353732-14353754 AGGTGGGGGAGGCAGGAGGGAGG + Intergenic
1135114398 16:19712909-19712931 GAGTGGGAGAGGGAGGCCTGAGG - Intronic
1135892128 16:26366668-26366690 CAGAGGGAGAGGGAGGAGGGTGG + Intergenic
1135955472 16:26953118-26953140 TGGTGGGTGAGGCAGGGAGGCGG - Intergenic
1136096836 16:27962960-27962982 GAGTGGGAGAGGCTGGTGGATGG - Intronic
1136197960 16:28667017-28667039 AAGTGGGAGAGGAAGGGGGAGGG + Intergenic
1136259027 16:29061039-29061061 AAGTGGGAGAGGAAGGGGGAGGG + Intergenic
1136293489 16:29289494-29289516 CAGAGGGAGGGGCAGGCGTGTGG + Intergenic
1136545337 16:30951126-30951148 TAGGTGTAGAGGCTGGCGGGTGG - Intronic
1136845279 16:33571857-33571879 CACTGGGAGACGCAGGCAGGGGG - Intergenic
1137341131 16:47606861-47606883 TAGAGTGAGAGGCAGTGGGGAGG - Intronic
1137482740 16:48865824-48865846 GAGTGAAAGAGGCAGGTGGGGGG - Intergenic
1137537755 16:49340337-49340359 TATGGGGAGAGGCAGGTTGGGGG - Intergenic
1137669238 16:50269727-50269749 CAGTGGGAGAGGTAGGAGAGAGG - Intronic
1137691861 16:50433965-50433987 AAGTGGGAGAGGCACGGGGGAGG - Intergenic
1137996386 16:53219030-53219052 TACTGGGAGAGGCATGAGAGGGG + Intronic
1138197207 16:55060485-55060507 GAGTGGGTGAGGCAGGCAGCAGG - Intergenic
1138453373 16:57106731-57106753 TGGTGGGAGATGCAGGGGTGTGG + Intronic
1138535800 16:57659704-57659726 AAGTGGGAGAGGCAGGTCTGAGG - Intronic
1138649913 16:58454064-58454086 AAGTGGAAGAGGGAGGCAGGAGG - Intergenic
1139394582 16:66630317-66630339 GAGAGGGAGAGGGAGGGGGGAGG - Intronic
1139444246 16:66987090-66987112 AAGTGGCAGAGGCAGGGGTGGGG + Intergenic
1139667935 16:68471411-68471433 AGGTGGGAGAGGCTGGCAGGGGG - Intergenic
1140264670 16:73409975-73409997 TAGTGGGTGGGGCAGGGGGGTGG + Intergenic
1140339979 16:74148317-74148339 CTGTGGGAGAGGCAGGTGGATGG - Intergenic
1140424286 16:74847975-74847997 TAAAGGGAGGAGCAGGCGGGAGG + Intergenic
1140442690 16:74999485-74999507 GGGCGGAAGAGGCAGGCGGGCGG - Exonic
1140825421 16:78701601-78701623 GTGTGGGGGAGGCAGGTGGGTGG - Intronic
1141137777 16:81477882-81477904 AAGTGGGAGTGGCAGGGGAGTGG + Intronic
1141641818 16:85346085-85346107 TAGATGGAGGGGCGGGCGGGTGG + Intergenic
1141642270 16:85348257-85348279 TAGATGGAGGGGCAGGTGGGTGG - Intergenic
1141732255 16:85830389-85830411 TCCTGGGAGAGGCAGGCTGGGGG - Intergenic
1141760583 16:86026240-86026262 CAGTGGGGGAGGCAGGCAGAGGG + Intergenic
1142099369 16:88263500-88263522 CAGAGGGAGGGGCAGGCGTGTGG + Intergenic
1142116449 16:88358521-88358543 GGGTGGGAGTGGCAGGCTGGTGG - Intergenic
1203106987 16_KI270728v1_random:1420510-1420532 CACTGGGAGACGCAGGCAGGGGG - Intergenic
1203155447 16_KI270728v1_random:1872155-1872177 CACTGGGAGACGCAGGCAGGGGG - Intergenic
1142686998 17:1583170-1583192 GAGTGGGAGGGGCAGGTGGGAGG - Intronic
1142893941 17:2962762-2962784 TAGGGCGAGAGGAAGGCAGGAGG + Intronic
1143544495 17:7588428-7588450 GAGTGGGAGAGCCAGGGGGCAGG + Exonic
1143590692 17:7884748-7884770 CGGTGGGGGAGGCGGGCGGGCGG + Intronic
1144003581 17:11078302-11078324 TAATGGGAGAGGCTGGCGGTGGG - Intergenic
1144886096 17:18463204-18463226 TACTGGGAGGGGCGGGAGGGAGG + Intergenic
1145026901 17:19475319-19475341 GAGAGGGAGAGGGAGGGGGGAGG - Intergenic
1145102149 17:20086298-20086320 TAGGGGGAGAGACAGGAGGTGGG - Intronic
1145146111 17:20481165-20481187 TACTGGGAGGGGCGGGGGGGAGG - Intergenic
1145236888 17:21214555-21214577 CAGCGGGAGAGGCAGCCTGGCGG - Exonic
1146792869 17:35762716-35762738 TGGTGGGGTGGGCAGGCGGGTGG - Intronic
1147168219 17:38604541-38604563 TGGTGGGAGAGGACGGCGGAGGG - Intronic
1147316273 17:39621907-39621929 TGGAGGGAGTGGGAGGCGGGGGG + Intergenic
1148130951 17:45262322-45262344 TAGAGCGAGAGGCAGGCGGCAGG + Intergenic
1148180521 17:45601668-45601690 TCCTTGGAGAGGCAGGCAGGAGG + Intergenic
1148268378 17:46244226-46244248 TCCTTGGAGAGGCAGGCAGGAGG - Intergenic
1148550929 17:48550518-48550540 TAGAGGGAGGGGCCGGCAGGGGG + Exonic
1148603134 17:48908873-48908895 TAGTGGGAGAGGGTGGGGGGCGG - Intronic
1148677828 17:49455391-49455413 AAGTGGGAGAGGGAGGGTGGAGG - Intronic
1148937999 17:51180400-51180422 TAGTCGGGGGGGCAGGGGGGTGG - Exonic
1149478955 17:56986180-56986202 TAATGCGAGAGGGAGGCTGGAGG - Intronic
1149535641 17:57431450-57431472 TACAGGGAGAGGCAGGTGGTAGG + Intronic
1149794351 17:59505679-59505701 TACTGGGAGAGGGAAGCAGGAGG + Intergenic
1149809014 17:59648936-59648958 TATTGGGAGACCAAGGCGGGAGG - Intronic
1149818132 17:59747312-59747334 CATTGGGAGAGGGAGGCAGGGGG + Intronic
1151124268 17:71828031-71828053 TAGTGGGAGATGTATGAGGGTGG + Intergenic
1151408814 17:73907221-73907243 TAGTGGGCAAGGGAGGAGGGAGG + Intergenic
1151438689 17:74114475-74114497 TGGGGGCAGGGGCAGGCGGGAGG + Intergenic
1151592053 17:75051644-75051666 TGGTGGGAGAGGCAAGAGGATGG - Intronic
1151821324 17:76498421-76498443 GAGGGGGAGAGGCAGCCAGGAGG + Intronic
1152214925 17:79026610-79026632 GAGGAGGAGAGGGAGGCGGGAGG - Intronic
1152245630 17:79183268-79183290 TGGAGGTAGAGGAAGGCGGGCGG + Intronic
1152334738 17:79694215-79694237 AAGTGGAAGACGGAGGCGGGAGG + Intergenic
1152535547 17:80948645-80948667 GAGCGGGACAGGCAGGTGGGTGG + Intronic
1152909056 17:82986935-82986957 TAGTGGGACAGGGAGGAGCGGGG - Intronic
1153401438 18:4687688-4687710 TAGTTGGAGAAGGAGTCGGGGGG - Intergenic
1153991801 18:10406818-10406840 TGATGGAAGAGGCAGGAGGGAGG - Intergenic
1155159367 18:23183189-23183211 CACTGGGAGAGGCAGGCCCGAGG - Intronic
1155512867 18:26594993-26595015 AAGTGGGAGAGGGAGAGGGGAGG - Intronic
1156454222 18:37283817-37283839 TTGTGGGAGAGGCAAGGGGTGGG + Intronic
1157168106 18:45377056-45377078 TAGTGGAAGAGGCAGTCAGATGG - Intronic
1159998810 18:74995668-74995690 TGGTGGGAGAGGCAGAAGGGAGG + Intronic
1160392223 18:78542761-78542783 TAATGAGAGAGGCAGGTGTGAGG + Intergenic
1160553488 18:79711322-79711344 TGGTTGGAGAGGCAGGAGGCAGG + Intronic
1160684421 19:426879-426901 CAGTGCGAGACGCAGGCGGGTGG + Intronic
1160818136 19:1045660-1045682 TGGTGGGGGAGGGGGGCGGGGGG - Intronic
1160867505 19:1262377-1262399 TGCTGGGAGAGGAGGGCGGGTGG - Intronic
1160906773 19:1455363-1455385 TGCTGGCAAAGGCAGGCGGGCGG - Exonic
1161400760 19:4065619-4065641 GCGTGGGGGAGGCGGGCGGGCGG - Intronic
1161573898 19:5045129-5045151 CAGTGGGACAGGTGGGCGGGAGG - Intronic
1161610084 19:5237619-5237641 GAGTGGCTGGGGCAGGCGGGGGG + Intronic
1161620715 19:5295521-5295543 TGGTGGGAGAGGCAGACCCGGGG - Intronic
1161736538 19:5995281-5995303 GAGTGGGACAGGCAGGCCAGAGG - Intronic
1161981208 19:7631383-7631405 TGGTGGGAGAGGTGGGCGGGGGG + Intronic
1162018973 19:7860189-7860211 TGGTGGGCGAGGCAGGGGGTGGG - Intronic
1162564074 19:11435539-11435561 TGTTGGGAGAGGCAGGAGTGGGG - Intronic
1162743406 19:12786145-12786167 AGGTGGGAGAGGGAGGCGGCTGG + Intronic
1162808193 19:13149940-13149962 CGGGGGCAGAGGCAGGCGGGAGG - Intronic
1163323593 19:16588807-16588829 CAATTGGACAGGCAGGCGGGGGG - Intronic
1163616455 19:18331805-18331827 AAGAGGGAGAGGCAGGAGTGGGG + Intergenic
1164066235 19:21720255-21720277 GAGAGGGAGAGGGAGACGGGAGG - Intergenic
1164231764 19:23295105-23295127 TAGTGGTGGAGGCAGGAGTGGGG - Intergenic
1164247904 19:23449601-23449623 TAGTGGTGGAGGCAGGAGTGGGG - Intergenic
1164405240 19:27938369-27938391 TTCTGGGAGAGGCAGGGGGATGG + Intergenic
1164466571 19:28491957-28491979 TAGTGGGAAAGGTAGGGGGTGGG + Intergenic
1164606823 19:29605612-29605634 CCGTGGGAGGCGCAGGCGGGAGG - Exonic
1164827767 19:31297015-31297037 CAGTGGGAGCGGGAGGTGGGAGG + Intronic
1164913353 19:32029900-32029922 TAGTGGGAAATGCAGGTGGCAGG - Intergenic
1164998976 19:32745061-32745083 TAGTGGGGGGGGCTGGCTGGAGG - Intronic
1165902398 19:39174891-39174913 CAGTGGTGGAGGGAGGCGGGAGG - Intronic
1165995175 19:39839003-39839025 TAGATGGAGAGTCAGGCAGGAGG - Intronic
1166257581 19:41617600-41617622 AAGTGAGAGAGGGAGGTGGGAGG + Intronic
1166559060 19:43719962-43719984 TTGTGGGTGAGGCAGGGGGGCGG - Exonic
1166760918 19:45224152-45224174 TAGTGGGAGAGCCAGGAGTGGGG + Intronic
1166893806 19:46010557-46010579 CTGTGGGAGAGGGAGGCAGGAGG + Intronic
1167045292 19:47045836-47045858 TAACTGGAGAGGCAGGAGGGCGG - Intergenic
1167072263 19:47228062-47228084 AAGTGGGAGAGGACGGGGGGAGG - Intronic
1167077194 19:47257035-47257057 TAGTGGGGGAGCCAGGGGGCGGG + Intronic
1167456458 19:49598841-49598863 TAGGGAGAGAGGCAGGAGGTTGG + Intronic
1167560010 19:50221307-50221329 AAGTCAGAGAGGCAGCCGGGCGG + Intronic
1168093886 19:54103360-54103382 TAGGTGGAGAGGAACGCGGGGGG - Intronic
1168317020 19:55488958-55488980 CAGTGTGAGGGGCAGGCCGGGGG - Intronic
1168383271 19:55942238-55942260 TGATGGGAAAGGCAGGTGGGAGG - Intergenic
926001671 2:9338533-9338555 TGGCAGGAGAGGCAGGCAGGTGG - Intronic
926726876 2:16005316-16005338 GAGAGGGAGAGGGAGGGGGGAGG - Intergenic
927524629 2:23726524-23726546 GAGGGGGAGAGGCAGGAGGAAGG + Intergenic
927828892 2:26330932-26330954 CAGTGGGAGAGACAGGGTGGAGG + Intronic
928175195 2:29028659-29028681 TAGTGAGAGAGAAAGGCAGGAGG + Intronic
928395661 2:30941656-30941678 TAGTGGGAGAGGAAGGGATGAGG - Intronic
929079342 2:38107001-38107023 TAGTGGCAGAGGAAAGCGGCTGG - Intronic
929467495 2:42158419-42158441 TAGTGGGAGAGGTAAGGGTGAGG + Intergenic
929558057 2:42937686-42937708 TGGTGGGGGAGGAGGGCGGGAGG - Intergenic
929687134 2:44044667-44044689 TACGGGGACAGGCAGGTGGGAGG - Intergenic
929969921 2:46565171-46565193 TAGTGGGAGGGGCAGGAGTGGGG + Intronic
931375785 2:61706698-61706720 TTGTGAGAGAACCAGGCGGGAGG - Intergenic
931452530 2:62380146-62380168 TAGTAGTAGAGGCAGGTGGTGGG + Intergenic
931514122 2:63032323-63032345 TTTTGGGAGGCGCAGGCGGGTGG + Intronic
932207971 2:69900669-69900691 TAATGGGAGAGGGAGGAGGTGGG + Intronic
932487146 2:72091074-72091096 TGGTGGGAATGGCAGGCGTGTGG + Intergenic
932687735 2:73887404-73887426 CTTTGGGAGACGCAGGCGGGAGG + Intergenic
932770511 2:74498420-74498442 TAGAGGGAGAGCCAGGAAGGCGG + Intronic
932917563 2:75874718-75874740 TAGTTGGAGAAGGAGTCGGGGGG - Intergenic
933901860 2:86855861-86855883 TAGTGGGAGACTCAGGTTGGGGG + Intronic
935070248 2:99687650-99687672 TAGAGGGAGAATCAGGCTGGTGG + Intronic
937111108 2:119367605-119367627 GATTGGCAGAGGCAGGCGGGAGG - Exonic
937960277 2:127453033-127453055 TAGTGGAGGACTCAGGCGGGTGG - Intronic
938070525 2:128305933-128305955 GAGTGGGGGAGCCAGGCGTGTGG - Intronic
938244307 2:129765351-129765373 GAGAGGGAGAGGCAGGGAGGGGG - Intergenic
942002345 2:171661091-171661113 TAGTGGGAGACCGAGGCGGAAGG - Intergenic
942833393 2:180263746-180263768 TAGTGGGAGAAGAAGGAGAGGGG + Intergenic
943403810 2:187454024-187454046 TATTGGGCAAGGCAGGTGGGTGG - Intergenic
943756610 2:191563678-191563700 TAGTGGGGGTGGGAGGCAGGTGG + Intergenic
943769916 2:191705223-191705245 GAGTGGGAGAGGAAGGTGGTGGG + Intergenic
944547449 2:200812047-200812069 CAGAGGGAGAGGGAGGCGGCGGG + Intronic
944644981 2:201770678-201770700 AAGTGGAAGAGGGAGGCAGGAGG + Intronic
946203987 2:218090086-218090108 GAGTGGGATGGGCAGGCAGGTGG - Exonic
948231278 2:236351302-236351324 AAGTGGGAGAAGTGGGCGGGTGG + Intronic
948259170 2:236590284-236590306 GAGTGGGTGAGGCAGGAGAGGGG - Intergenic
948458569 2:238118492-238118514 TGGTGGGAGATGGAGGAGGGTGG + Intronic
1168961160 20:1871035-1871057 GAGTGTGAGAGGCAGGGGTGCGG + Intergenic
1169046622 20:2538353-2538375 GAGTGGATGAGGCAGGCAGGTGG - Intronic
1169193257 20:3670730-3670752 TGGTGGGAGAAGCAGGAGAGTGG + Intronic
1169342880 20:4809748-4809770 GAGTGGGGGAGGCAGGACGGGGG + Intronic
1169437464 20:5605726-5605748 TGGAGGGGGAGGCAGGTGGGGGG - Intronic
1170009079 20:11701177-11701199 TTGTGGGCAAGGAAGGCGGGAGG - Intergenic
1170884246 20:20325389-20325411 TTGTGGGGGAGGCAGGAGGAAGG - Intronic
1170936252 20:20812419-20812441 TAGAGGAAAAGGCAGGCTGGCGG - Intergenic
1171944658 20:31365872-31365894 TTCTGGGGGAGGCAGGAGGGAGG + Intergenic
1173256072 20:41395077-41395099 GTGTGGGAGGGGCAGGCTGGTGG + Intergenic
1174001757 20:47379888-47379910 TAGTGGGAGGAACAGGCTGGGGG + Intergenic
1174061426 20:47835667-47835689 AAGTGGTGGGGGCAGGCGGGGGG - Intergenic
1174070100 20:47893656-47893678 AAGTGGTGGGGGCAGGCGGGGGG + Intergenic
1174101220 20:48127522-48127544 AAGTGGTGGGGGCAGGCGGGGGG - Intergenic
1174156293 20:48517569-48517591 AAGTGGTGGGGGCAGGCGGGGGG - Intergenic
1174863760 20:54116059-54116081 TAGTGGGGGTGGCGGGGGGGCGG - Intergenic
1176383516 21:6125740-6125762 TGGTGGGAGAGGCCGGGGAGGGG + Intergenic
1177730671 21:25024326-25024348 CAGTGAGCCAGGCAGGCGGGTGG + Intergenic
1179626771 21:42653545-42653567 GAGGGGGAGGGGCGGGCGGGCGG + Intergenic
1179633069 21:42690684-42690706 GTGTGGGAGAGGCAGGCTGGAGG - Intronic
1179739954 21:43412498-43412520 TGGTGGGAGAGGCCGGGGAGGGG - Intergenic
1179818940 21:43925337-43925359 GACTGGGAGGGGCAGGAGGGTGG - Exonic
1179907778 21:44433189-44433211 CAGTGGCAGAGCCAGGAGGGAGG - Intronic
1180044746 21:45300092-45300114 TAGCGGCAAAAGCAGGCGGGTGG + Intergenic
1180168014 21:46040117-46040139 TCCTGGGAGAGGCTGGAGGGAGG - Intergenic
1181009553 22:20032475-20032497 TGGAGGAAGAGGCAGGCAGGAGG - Intronic
1181462795 22:23095264-23095286 CAGTGGGAGCCGGAGGCGGGGGG + Exonic
1181635958 22:24174977-24174999 TGGTGGGACAGGCAGGCAGAGGG - Intronic
1181670328 22:24422894-24422916 TAGTGGCAGAGGCAGCAGTGAGG + Intronic
1182110453 22:27719411-27719433 CAGTGGGAGAGAAAGGAGGGAGG - Intergenic
1182369660 22:29801973-29801995 AGGTGGGAGAGACAGGTGGGAGG - Exonic
1182673885 22:32021972-32021994 TAGTGGGAGAGGCAGGGCATGGG + Intergenic
1183635886 22:39062355-39062377 TAGCGAGAGAGGAAGGCTGGAGG + Intronic
1184148101 22:42623270-42623292 TTGTGGGAGAGCCAAGCTGGAGG - Intronic
1184240161 22:43207630-43207652 CAGGGGGAGAGGAAGGCGAGGGG + Intronic
1184696388 22:46141447-46141469 CACTGGGAGACGCAGGCAGGGGG + Intergenic
1184795287 22:46728629-46728651 GGGTGGGAGAGACAGGCGGTCGG - Intronic
1185061590 22:48609856-48609878 TGGAGGCAGAGGCTGGCGGGAGG - Intronic
1185339454 22:50284993-50285015 CAGTGGAGGAGGCAGGCGTGTGG - Intronic
949431847 3:3985323-3985345 TAGTGGAAGAGGCTGGTGGCAGG - Intronic
949710192 3:6862724-6862746 TAGTGGGTGAGGGGGGCGGGGGG - Intronic
950094312 3:10319877-10319899 GAGAGGGAGAGGAAGGGGGGAGG + Intronic
950094334 3:10319954-10319976 GAGAGGGAGAGGAAGGGGGGAGG + Intronic
951547600 3:23844078-23844100 TTGTGGGAGAGCCATGTGGGTGG + Intronic
952549112 3:34456012-34456034 TAGTAGGGGAGGCAGAAGGGGGG - Intergenic
953261080 3:41339501-41339523 GAGTGGGAGAAGCAGGAGAGGGG - Intronic
953661713 3:44895539-44895561 CAGTTGGAGAGGGAGGTGGGTGG + Intronic
953707903 3:45245049-45245071 TAGTGGGAGAGACAAGGAGGTGG + Intergenic
954252599 3:49379757-49379779 CACTGGGAGAGACAGGCAGGAGG - Intronic
954368294 3:50157360-50157382 AAGGGAGGGAGGCAGGCGGGAGG - Intronic
954644673 3:52123803-52123825 TAGTAGGAGAGGCAGCCTGGTGG - Intronic
955271590 3:57505248-57505270 TAGTGGGAGAAGTGGGCGGGGGG - Intronic
957194053 3:77045045-77045067 TGTTGGGGGAGGGAGGCGGGCGG + Intronic
958024325 3:88032967-88032989 TTTTGGGAGACGGAGGCGGGAGG + Intergenic
958543558 3:95510810-95510832 TTGTGGGAGGGACAGGTGGGAGG + Intergenic
961035482 3:123638736-123638758 GAGTAGGAGAGGCAGGAGGGAGG - Intronic
961117318 3:124341749-124341771 TAGTGTGAGAGACAGGCCTGTGG + Intronic
961204098 3:125067210-125067232 TATTGGGAGAGGCGGACAGGAGG + Intergenic
961322093 3:126083568-126083590 CTGTGGTAGAGGCTGGCGGGAGG + Intronic
961368813 3:126417520-126417542 CAGTTGGAGAGGCAGGCAGGGGG + Intronic
961432247 3:126891426-126891448 TAGTGGGAGTGGGAGATGGGCGG + Intronic
961563698 3:127748367-127748389 AGGTGGGAGAGGGAGGAGGGAGG + Intronic
961584599 3:127911536-127911558 CAGGGGGAGAGTCAGGCCGGTGG - Intergenic
961685015 3:128624040-128624062 TAGTCGGAGATGCGGGGGGGCGG - Intronic
962311876 3:134332568-134332590 TAGGGGGAGAGGAGGTCGGGCGG - Intergenic
962930984 3:140035797-140035819 AAGTTGGAGAGGCAGGCAGAGGG - Intronic
963200268 3:142578898-142578920 TAGGGGGCGGGGCAAGCGGGCGG + Intergenic
963829737 3:149993528-149993550 TGGTGGGTCAGGCAGGTGGGTGG - Intronic
964113669 3:153113017-153113039 CTTTGGGAGAGGGAGGCGGGTGG + Intergenic
966864546 3:184249967-184249989 AAGAGGGATAGACAGGCGGGAGG - Intronic
967463689 3:189777438-189777460 TTTTGGGAGACGGAGGCGGGTGG - Intronic
967788117 3:193519356-193519378 GAGTTGGAGAGGAAGGCAGGTGG - Intronic
967886643 3:194337880-194337902 TGGTGGGGGAGTCAAGCGGGTGG + Intergenic
968282683 3:197489263-197489285 CGGTGGGAGAAGCAGGCCGGTGG - Intergenic
968880676 4:3297479-3297501 TAGAGGGACAGGGAGGCTGGTGG - Intronic
969267410 4:6073523-6073545 TAGTGGGGGAGGCAGGGTGTAGG + Intronic
969439911 4:7210886-7210908 TTTTGGGAAAGGCAGGCAGGGGG + Intronic
970334884 4:15026467-15026489 TTTTGGGAGACCCAGGCGGGTGG - Intronic
970533454 4:17005540-17005562 AAGCGGGGGAGGGAGGCGGGGGG - Intergenic
972607423 4:40626690-40626712 TATGGGGAGAGGCAGTGGGGAGG - Intronic
972639390 4:40911883-40911905 TAGGGGCAGAGGGAGGAGGGAGG - Intronic
973320117 4:48801504-48801526 TAGTAGGAGAGAGAGGCAGGTGG + Intergenic
973701140 4:53538430-53538452 TAGTGGAGGAGGCAGGCATGAGG + Intronic
973752168 4:54032273-54032295 TAGAGGGAGAGGGAGGGGGAGGG - Intronic
974066368 4:57081378-57081400 GAGTGGGAGGGGCTGGTGGGGGG - Intronic
975393742 4:73851646-73851668 TTGTGGGAGAGGCAGACAAGTGG + Intergenic
981255416 4:142656022-142656044 TAGTGAGACAGCCAGGTGGGAGG + Intronic
981443201 4:144806601-144806623 TGGTGGTAGTGGCAGGTGGGTGG - Intergenic
981998581 4:151001543-151001565 TGGTGGTAGCGGCAGGTGGGGGG - Intronic
983680743 4:170350785-170350807 TATTGGTAGAGGCAAGCGGAAGG - Intergenic
984620326 4:181944863-181944885 AAGTGGAAGAGGAAGGAGGGAGG - Intergenic
985560422 5:583334-583356 GAGTGGGAGAGGCAGTCCTGAGG + Intergenic
985573904 5:664938-664960 TAGGAGGAGGGGCAGGAGGGAGG + Exonic
985837017 5:2278937-2278959 TGGTGGGAGCGGCGGGCGGCGGG + Intergenic
986470357 5:8067681-8067703 GAGTGGGAAAGGAAGGCTGGAGG + Intergenic
987709485 5:21490600-21490622 TATTGGGAGACTGAGGCGGGTGG + Intergenic
988750128 5:34183572-34183594 TATTGGGAGACTGAGGCGGGTGG - Intergenic
988771704 5:34439346-34439368 TAGAGGGAGAAGCAGGTGGCTGG - Intergenic
990676696 5:58194427-58194449 TAGGGGGAGGGGGAGGGGGGAGG + Intergenic
991074007 5:62514624-62514646 GAGAGGGAGAGGGAGACGGGAGG + Intronic
991286664 5:64984440-64984462 TAGCTGGAGATGCAGGTGGGAGG + Intronic
991291245 5:65035555-65035577 TAGTGGCGGCGGGAGGCGGGAGG + Intergenic
991738388 5:69646772-69646794 TATTGGGAGACTGAGGCGGGTGG - Intergenic
991759805 5:69909654-69909676 TATTGGGAGACTGAGGCGGGTGG + Intergenic
991787526 5:70208461-70208483 TATTGGGAGACTGAGGCGGGTGG - Intergenic
991789964 5:70226511-70226533 TATTGGGAGACTGAGGCGGGTGG - Intergenic
991814712 5:70501607-70501629 TATTGGGAGACTGAGGCGGGTGG - Intergenic
991817848 5:70522888-70522910 TATTGGGAGACTGAGGCGGGTGG - Intergenic
991839035 5:70784720-70784742 TATTGGGAGACTGAGGCGGGTGG + Intergenic
991879972 5:71208830-71208852 TATTGGGAGACTGAGGCGGGTGG - Intergenic
991882412 5:71226854-71226876 TATTGGGAGACTGAGGCGGGTGG - Intergenic
992047497 5:72908816-72908838 TACTGGGAGGGGCGGGAGGGAGG + Exonic
992632789 5:78698072-78698094 TAGTGGGAAAGGCAGAGGGGTGG - Intronic
993383132 5:87231398-87231420 TTTTGGGAGATTCAGGCGGGTGG - Intergenic
996610705 5:125376386-125376408 TAGTGGTAGAGGCTTGGGGGAGG - Intergenic
997660432 5:135585223-135585245 TGGTGAGAGAGGCAGGAGGTGGG - Intergenic
998135079 5:139670192-139670214 GCGTGGGGGAGGCAGGCGAGAGG - Intronic
999181455 5:149672550-149672572 CATTGGGAGATGGAGGCGGGTGG + Intergenic
999273770 5:150314615-150314637 TGGTGGCAAAGGCAGGCAGGAGG - Intronic
999586493 5:153095165-153095187 AAGTCGGGGAGGGAGGCGGGCGG + Intergenic
999800679 5:155030989-155031011 TTTTGGGAGACCCAGGCGGGTGG - Intergenic
1000033210 5:157420786-157420808 GAGTGGGAAGGGCAGGAGGGGGG + Intronic
1000335388 5:160238115-160238137 TAGTGGGAGAGGCAGGCGGGGGG - Intronic
1002017505 5:176336803-176336825 CAGAGACAGAGGCAGGCGGGTGG - Exonic
1002105028 5:176875812-176875834 TGGTGGGAGGGGCAGGGGGTCGG - Intronic
1002367781 5:178726645-178726667 AAGTGGGAAAGGCAGGTGGTAGG + Intronic
1002455982 5:179345523-179345545 GAGCGAGGGAGGCAGGCGGGAGG + Intergenic
1002888866 6:1317170-1317192 TGGGGGGAGGGGTAGGCGGGAGG - Intergenic
1003310418 6:4965394-4965416 GAGTGGGAGGGGCAGGAGGGAGG - Intergenic
1004338411 6:14785089-14785111 CAATGGGAGAGGGAGGCTGGCGG - Intergenic
1004510084 6:16278047-16278069 CCGTGGGACAGGCAGGCAGGAGG + Intronic
1005548191 6:26889889-26889911 TATTGGGAGACTGAGGCGGGTGG - Intergenic
1005578044 6:27208329-27208351 TAGTGAGACAGCCAGGTGGGAGG - Intergenic
1005622268 6:27630977-27630999 CAGAGGGAGGGGCAGGCGGCGGG + Intergenic
1006017166 6:31091138-31091160 TAGTGAGACAGCCAGGTGGGAGG + Intergenic
1006945918 6:37784455-37784477 TGGAGGGAGAGGGAGGCGGTGGG + Intergenic
1007523776 6:42473256-42473278 TAGGGGCAGAGGTAGGAGGGAGG - Intergenic
1007676206 6:43597356-43597378 TTTTGGGAGAGCAAGGCGGGTGG - Intronic
1007967381 6:46015420-46015442 TGGTGGGTGAGCCCGGCGGGAGG + Intronic
1008592403 6:53007684-53007706 CAATGGGAGACCCAGGCGGGTGG + Intronic
1009018952 6:57930996-57931018 TATTGGGAGACTGAGGCGGGTGG - Intergenic
1009808699 6:68634981-68635003 GCGGGGGAGAGGCTGGCGGGAGG - Intergenic
1010453119 6:76025938-76025960 TGGTGAGAGAGCCAGGTGGGAGG + Intronic
1011007278 6:82660269-82660291 TAGTGGTAGAGGGAAGCAGGTGG + Intergenic
1011010246 6:82695461-82695483 TCGTGGCAGGGGCAGGCAGGTGG - Intergenic
1011285094 6:85714822-85714844 TAGTGGGGGTTGCAGGGGGGTGG - Intergenic
1013182755 6:107731993-107732015 CAGTGGGAGAGGCTGCCGGGTGG - Intronic
1013591851 6:111625562-111625584 CAGAGTAAGAGGCAGGCGGGCGG - Intergenic
1015059625 6:128947777-128947799 TAGAGGGAGACGCAGGCCTGAGG + Intronic
1015869373 6:137760513-137760535 TACTGGGAGAGGCAGACAGCTGG + Intergenic
1016091582 6:139985687-139985709 GAGTGAGAGAGGAAGGAGGGAGG - Intergenic
1018239608 6:161760437-161760459 TAGTGGGACAGCCAGGTGGGAGG + Intronic
1018654671 6:166024161-166024183 TAGGGGGAGAGGGAGGCGGATGG + Intergenic
1018939879 6:168302012-168302034 TCGGGGAAGAGGCAGGCGGAGGG - Intronic
1018959942 6:168441108-168441130 GAGGGAGAGAGGCGGGCGGGAGG + Intergenic
1019221046 6:170473111-170473133 AAGTAGGTGAGGCAGGCAGGTGG - Intergenic
1019294982 7:269284-269306 TGGTGGGAAAGGCAGGGAGGGGG + Intergenic
1019407105 7:889558-889580 AGGTGGGAGAGGCAGGCGCCTGG + Intronic
1019494773 7:1332587-1332609 TTGAGGGCGAGGCAGGAGGGGGG - Intergenic
1019516394 7:1442071-1442093 GAGACGGAGAGGAAGGCGGGCGG + Intronic
1020082977 7:5296496-5296518 TAGAGGGAGCGGCAGGGGGTGGG + Intronic
1020378825 7:7519320-7519342 TGGTGGGAGAGACTGGTGGGAGG - Intronic
1021403759 7:20240033-20240055 TAGTGGGAGAGAGAGGGAGGTGG - Intergenic
1022591213 7:31665070-31665092 TAGTGAGAGAGGAAGGAGGAAGG - Intergenic
1023245542 7:38199511-38199533 TAGTGGGAGAGGCAGTGAAGTGG + Intronic
1025623063 7:63191901-63191923 TAGAGGGAGAGACGGACGGGTGG + Intergenic
1025911736 7:65834018-65834040 CTTTGGGAGAGCCAGGCGGGTGG + Intergenic
1026515500 7:71067313-71067335 TAATGTGAGAGGGAGGTGGGGGG - Intergenic
1026865771 7:73823128-73823150 TGGAGGGAGAGTCAGGAGGGTGG - Intronic
1026928636 7:74210593-74210615 GAGGGAGAGAGGGAGGCGGGCGG - Intronic
1026940704 7:74286397-74286419 TGGGTGGGGAGGCAGGCGGGGGG - Intergenic
1028187403 7:87802874-87802896 TATTGGGAGATGGAGGTGGGAGG + Intronic
1028520183 7:91721247-91721269 TAGTGGGCCAGGCAGGTGGGTGG - Intronic
1029283583 7:99451797-99451819 GTGTGGGCGAGGCAGCCGGGAGG - Intronic
1029381665 7:100219435-100219457 TAGTGGGCGAGCCAGGCTGGGGG + Intronic
1029401826 7:100351883-100351905 CAGTGGGCGAGCCAGGCTGGGGG + Intronic
1029433256 7:100546163-100546185 TGGTGGGGGTGGCGGGCGGGGGG - Intronic
1029707511 7:102283560-102283582 TGGTGGCAAAGGCAGGCTGGGGG - Intronic
1030675673 7:112383378-112383400 CCCTGGGAGAGGCAGGTGGGTGG - Intergenic
1031602055 7:123722008-123722030 TGGGGGCAGGGGCAGGCGGGAGG + Intronic
1032053291 7:128663227-128663249 TTGTGGGAGGGACAGGTGGGAGG + Intergenic
1032338467 7:131048510-131048532 TTGTGGAAGAGGCAGAGGGGTGG - Intergenic
1032425634 7:131820207-131820229 GAGTGGGAGGGGCAGGCAGAGGG - Intergenic
1033047603 7:137976853-137976875 CAGTGGGAGAGGCCAGTGGGTGG + Intronic
1033050176 7:137997027-137997049 TAGGGGGAGAGGTTGGCAGGTGG - Intronic
1033168000 7:139058150-139058172 TAGTGGGGGAGGGTGGGGGGTGG - Intronic
1033316568 7:140302419-140302441 TTTTGGGAGATGGAGGCGGGTGG - Intronic
1033362370 7:140646841-140646863 GAATGAGAGAGGCAGGGGGGAGG - Intronic
1035038016 7:155908072-155908094 GAGAGGGAGAGGGAGGAGGGAGG + Intergenic
1035038031 7:155908124-155908146 TAGGGGGAGAGGAAGGAAGGTGG + Intergenic
1035182011 7:157096436-157096458 GCGTGGGAGAGGCAGTGGGGTGG + Intergenic
1035413814 7:158667454-158667476 TAGTGGGTAAGGCGGGCGGAGGG - Intronic
1035413824 7:158667483-158667505 TAGTGGGTAAGGCGGGCGGAGGG - Intronic
1035413883 7:158667654-158667676 TAGTGGGTAAGGAAGGCGGAGGG - Intronic
1035413892 7:158667683-158667705 TAGTGGGTAAGGCGGGCGGAGGG - Intronic
1035413994 7:158667973-158667995 TAGTGGGTAAGGAAGGCGGAGGG - Intronic
1035630829 8:1105477-1105499 TGGTGGGAGATGCAGGGAGGGGG + Intergenic
1035643414 8:1200569-1200591 CAGTGGGACGTGCAGGCGGGAGG - Intergenic
1036165187 8:6426097-6426119 TGATGGGAAAGGGAGGCGGGTGG - Intronic
1036778681 8:11630986-11631008 TAGTGGAGGAGGCAGACGGCAGG - Intergenic
1037876695 8:22552048-22552070 GAGTAGGCGAGGCCGGCGGGAGG + Intronic
1037880982 8:22573233-22573255 TAGTGGGGGAGGGAGGGAGGCGG + Intronic
1039053498 8:33515321-33515343 TACTGGGAGACTGAGGCGGGAGG - Intergenic
1039180122 8:34857652-34857674 CACTTTGAGAGGCAGGCGGGTGG + Intergenic
1039382511 8:37099541-37099563 TGGTGAGAGAGGCAGGAAGGAGG - Intergenic
1040897904 8:52388377-52388399 AAGTGGGAGTTGGAGGCGGGTGG - Intronic
1041723593 8:60998291-60998313 TAGTGGGATAGGCAGGAAGTAGG - Intergenic
1043358048 8:79437040-79437062 AGGTGGGAGAGGAAGGAGGGAGG - Intergenic
1048408336 8:134145713-134145735 TAATGGGGGAGACAGGCGGTGGG - Intergenic
1048977718 8:139682292-139682314 TAGTGCCAGACACAGGCGGGTGG + Intronic
1049009388 8:139877218-139877240 CAGTGGAAGAGGCAGGCGGAGGG + Intronic
1049368847 8:142253866-142253888 CAGTGGGTGAGGGAGGTGGGAGG + Intronic
1049545376 8:143228373-143228395 CTGCGGGAGAGGGAGGCGGGGGG + Intergenic
1049545385 8:143228390-143228412 GGGGGGGAGAGGGAGGCGGGGGG + Intergenic
1049697146 8:143989995-143990017 GGGTGGGAGGGGCAGGTGGGCGG - Intronic
1051223852 9:14878322-14878344 TAGTGGGGGAGAGAGGAGGGAGG - Intronic
1051334564 9:16054517-16054539 TAGTGGGGAAGGCAGGGGAGAGG - Intronic
1052829267 9:33201823-33201845 TTTTGGGAGATGGAGGCGGGTGG + Intergenic
1053218307 9:36290966-36290988 TTGTGGGTGACGCAGGCAGGAGG + Intronic
1053605325 9:39652531-39652553 TACTGGAAGGGGCAGGAGGGAGG - Intergenic
1053863240 9:42409158-42409180 TACTGGAAGGGGCAGGAGGGAGG - Intergenic
1054248218 9:62689885-62689907 TACTGGAAGGGGCAGGAGGGAGG + Intergenic
1054452297 9:65409756-65409778 TAGTGGGAGGAGCAGTCAGGGGG - Intergenic
1054562333 9:66724410-66724432 TACTGGAAGGGGCAGGAGGGAGG + Intergenic
1054863156 9:69973825-69973847 AAGTGCGAGAGGCAGGGAGGTGG + Intergenic
1055289207 9:74765200-74765222 TAGTGGTAGAGGCAGGGCTGGGG + Intronic
1056471735 9:86911286-86911308 TAGTGAGAGAGAGGGGCGGGGGG + Intergenic
1057630662 9:96716507-96716529 AAGTGGGAGAGGGAGGGGGACGG + Intergenic
1057802792 9:98200220-98200242 TGGTGGGAGTGGCAGGGGGTGGG + Intronic
1058699666 9:107589818-107589840 AAGTGGGAGAGGCTGCCCGGTGG - Intergenic
1058740853 9:107940647-107940669 TATAGGGAGAGGCAGCTGGGGGG + Intergenic
1059480562 9:114586262-114586284 TAGTGGGGGATGGAGGCGGTGGG - Intergenic
1059669374 9:116478216-116478238 TAGTGGGGGAGTAAGGGGGGAGG + Intronic
1060206924 9:121687527-121687549 TTGTGGGAGAGGCAGGGTGGTGG + Intronic
1060437614 9:123607873-123607895 CAGGAGGAGAGGCAAGCGGGAGG + Intronic
1060479769 9:124011411-124011433 TGGTGGGCGAGGCTGGAGGGCGG - Intronic
1060683478 9:125586334-125586356 GAGTGGAAGACGCAGGTGGGAGG - Intronic
1060809711 9:126604515-126604537 GAGTGGCAGAACCAGGCGGGTGG - Intergenic
1060985430 9:127816673-127816695 TGGTGGCAGAGGCAGGGGTGAGG - Intronic
1061132692 9:128716936-128716958 TGCTGGAAGAGGCAGGCAGGAGG - Intronic
1061206600 9:129167495-129167517 AAGTGGGAGAGGCAGGAGATGGG - Intergenic
1061261382 9:129482669-129482691 GAGGGGGAGAGGCGGGCGGCGGG + Intergenic
1185575506 X:1169081-1169103 TAGGAGGAGAGGAAGGTGGGAGG + Intergenic
1186207219 X:7213456-7213478 CGGTGGGAAAGGCAGGCAGGAGG + Intergenic
1186329253 X:8514691-8514713 AAGTGGAAGAGGGAGGCAGGAGG + Intergenic
1186979118 X:14939936-14939958 CAGTGGGAGGGGGAGGAGGGAGG - Intergenic
1188003545 X:25002726-25002748 TGGGGAGAGGGGCAGGCGGGAGG - Intergenic
1188535732 X:31194734-31194756 TTGTGGGCAAGGCAGGAGGGTGG + Intronic
1190061044 X:47211928-47211950 CAGAGGGCGAGGCAGGTGGGAGG - Intronic
1190108379 X:47574324-47574346 GAGACGGAGAGGCGGGCGGGCGG + Exonic
1190137005 X:47806821-47806843 TAGCTGGAGAGGCAGGCAGAGGG + Intergenic
1192146636 X:68686996-68687018 TAGTGGGACAGGAAGACAGGAGG - Intronic
1192153106 X:68724165-68724187 TAGGGGCAGAGGCAGGGGAGGGG - Intronic
1192337575 X:70234978-70235000 TAGTGGGAGGGGGCGGGGGGTGG + Intronic
1192434963 X:71137391-71137413 TAGTGAGAGGGGCAGTAGGGAGG + Intronic
1192830912 X:74750076-74750098 AAGTGGGAGAGACAGAGGGGGGG + Intronic
1193199455 X:78671147-78671169 TAGAGGGAAAGAAAGGCGGGAGG + Intergenic
1194707525 X:97193255-97193277 TACTGGGAGACTGAGGCGGGAGG - Intronic
1194950420 X:100119662-100119684 AAGTGGAAGAGTCAGGAGGGAGG - Intergenic
1197446038 X:126552885-126552907 CAGTGGGAGGAGCAGGCGGTCGG + Intergenic
1197486691 X:127060200-127060222 CACTTCGAGAGGCAGGCGGGCGG + Intergenic
1200204006 X:154302921-154302943 TAGCTGGAGAGGCAGGGGCGAGG + Intronic
1202087389 Y:21153257-21153279 TTGTGAGAGAGGCAGGCCAGAGG - Intergenic