ID: 1000340450

View in Genome Browser
Species Human (GRCh38)
Location 5:160273331-160273353
Sequence GAACACAGCTTCTCTAACAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 152}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1000340448_1000340450 1 Left 1000340448 5:160273307-160273329 CCAACAGCATTATAACTTCTGCC 0: 1
1: 1
2: 11
3: 70
4: 289
Right 1000340450 5:160273331-160273353 GAACACAGCTTCTCTAACAGAGG 0: 1
1: 0
2: 0
3: 10
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1000340450 Original CRISPR GAACACAGCTTCTCTAACAG AGG Intronic
900248397 1:1651007-1651029 GAACAAAGCTTTGCTATCAGTGG + Intronic
900259463 1:1717266-1717288 GAACAAAGCTTTGCTATCAGTGG + Intronic
900405938 1:2493020-2493042 GAACCCAGCCTCCCTGACAGAGG + Intronic
900500543 1:3002381-3002403 GAGCCCAGATTCACTAACAGAGG - Intergenic
901808553 1:11752684-11752706 GAACACGGCCTCACTCACAGTGG - Intronic
902726151 1:18337564-18337586 GAACACAGCTTCACGCACCGTGG + Intronic
904504134 1:30936877-30936899 AAGCACAGCCTCACTAACAGGGG - Intronic
908094783 1:60726059-60726081 AAACAGAGCTTGTCTAACAATGG - Intergenic
908414144 1:63896362-63896384 GAACACAGATTCTAGAACACTGG - Intronic
911495317 1:98624285-98624307 GAACACCTCTTCTCTTCCAGAGG - Intergenic
911812551 1:102301663-102301685 AAGCATAGCTCCTCTAACAGTGG + Intergenic
913347261 1:117820942-117820964 GAAGCCAGCTTCTCTATCAGAGG + Intergenic
914943560 1:152043849-152043871 GAAAACAGCTTATCTACTAGGGG - Intronic
915044392 1:152999958-152999980 AAACAAAGCTTCTCTGAAAGAGG + Intergenic
915704320 1:157829350-157829372 GAAGAGAGCTTTTCCAACAGAGG + Intergenic
917823003 1:178785213-178785235 GATTACAGCTCCTCAAACAGTGG - Intronic
919330913 1:196170613-196170635 GCATACAGTTTCTCTAACTGTGG + Intergenic
920444523 1:206005834-206005856 GCTCACATCTTCTCTAAAAGAGG - Intergenic
920546297 1:206821553-206821575 GAACACACTTTCTCTTCCAGAGG - Intronic
1063989547 10:11545188-11545210 CAACACAGCTTCTCCCACACAGG + Intronic
1065299635 10:24309573-24309595 GAACACAGTTTCTTCAACATTGG + Intronic
1067549464 10:47223664-47223686 TAACACAGCTCCTCTAAGACAGG - Intergenic
1068665823 10:59675022-59675044 GAACAGAAATTCTCTTACAGTGG + Intronic
1069768209 10:70879492-70879514 GACCACAGCTACTCTCAAAGAGG - Exonic
1071613228 10:87050705-87050727 GCACCCAGCTTCACTAACAGTGG - Exonic
1073124201 10:101139842-101139864 GGACACAGATTGCCTAACAGAGG + Intergenic
1074608124 10:114994557-114994579 AATTACAGCTTCTCAAACAGTGG - Intergenic
1075002323 10:118807984-118808006 GAACACACATTGTCTAGCAGAGG - Intergenic
1081588839 11:44407040-44407062 GAACATAGCTTCTCTGAAAAAGG + Intergenic
1083407313 11:62466809-62466831 GATCACAAATTCTCTATCAGGGG - Intronic
1086276487 11:85135591-85135613 AAACACAGCTTGTCTAGCATAGG + Intronic
1091919594 12:4293802-4293824 GAAGACAGAATCTGTAACAGTGG - Intronic
1094291058 12:28850623-28850645 GAAAACAGCTTCTCTGACCCAGG - Intergenic
1094490318 12:30956896-30956918 GGACACAGCTTCTGGAGCAGAGG - Intronic
1097494011 12:60306912-60306934 TTAAACAGCTTCTCTAACAATGG - Intergenic
1098000726 12:65939236-65939258 AAACACAGCTTCTCTGATACTGG + Intronic
1100139082 12:91594238-91594260 GAACAAAGCTTCTTCACCAGTGG - Intergenic
1107761945 13:43688792-43688814 GAACTCAGCTTGTCTAAAACTGG - Intronic
1109431769 13:62245882-62245904 GAAAACAGCTTATGCAACAGAGG + Intergenic
1110732690 13:78897506-78897528 GAACACAGCTTCTCAAATGTTGG - Intergenic
1115204335 14:30885868-30885890 GTGCACAGCTTCTGTACCAGAGG - Exonic
1117641759 14:57807500-57807522 GAACAAAACTTCCCTAAAAGTGG - Intronic
1118544834 14:66874336-66874358 GAACACATCTTCTCTTCCAAAGG + Intronic
1118790698 14:69089719-69089741 GATCACAGGTTCTCAACCAGGGG + Intronic
1119192957 14:72696749-72696771 GAACAGAGATTCTCAAACAGTGG + Intronic
1121181993 14:91936060-91936082 CAACACAGCTTCCCTAATAGTGG + Intronic
1123112806 14:105881012-105881034 GGACATAGCTTTTCTCACAGTGG + Intergenic
1123404341 15:20011131-20011153 GGACAAAGCTTTTCTCACAGTGG + Intergenic
1123513676 15:21017778-21017800 GGACAAAGCTTTTCTCACAGTGG + Intergenic
1127159834 15:56170581-56170603 GAACAGTGCTTCTCAACCAGAGG - Intronic
1128318500 15:66676515-66676537 GAACACACCAACTCAAACAGGGG + Intronic
1129604700 15:77019211-77019233 GGACACAGCCACCCTAACAGTGG + Intronic
1130284474 15:82543406-82543428 GCACACAGCTTCCCTAGGAGGGG + Intronic
1130985367 15:88841511-88841533 AAACACACTTTCTCTATCAGGGG - Intronic
1131215966 15:90535431-90535453 GAATACAGCATCTCTCACCGAGG - Intronic
1132573383 16:653738-653760 GTTCACAGCTTCTCTGACAGCGG + Exonic
1134002292 16:10792289-10792311 CAACACTGCTTCACTAGCAGTGG + Intronic
1134841684 16:17406650-17406672 GAACACAGCTTCTCTTCCCCAGG - Intronic
1151225660 17:72646390-72646412 TTACATAGCTTCTCCAACAGGGG - Exonic
1152407025 17:80103692-80103714 AAACACAGTCTCTGTAACAGTGG - Intergenic
1153414745 18:4834532-4834554 CCACACAGCTTCTCAAACATTGG - Intergenic
1156677176 18:39541740-39541762 GAAGAAAGCTTATCTAACAATGG - Intergenic
1159388201 18:67754666-67754688 GAACACAGCTCCTCTAAACAGGG + Intergenic
1163495738 19:17645656-17645678 GAACCCAGCTTCTCTCACCCAGG + Exonic
1163752771 19:19087984-19088006 GATTGCAGCTTCTCTAACACTGG - Intronic
1166579696 19:43883996-43884018 GAACTCTGCTTCTCTGATAGAGG - Intronic
1167143625 19:47669211-47669233 GAAGGAAGCTTCTCTAACACAGG - Intronic
1167278471 19:48552773-48552795 GAACACAGCTTCTCCCTCTGGGG - Intronic
1168088817 19:54068214-54068236 AAACACAGCTTTTCAACCAGGGG + Intergenic
926085850 2:10019999-10020021 GGACACAGCATCTCTAAAGGGGG - Intergenic
926174496 2:10577513-10577535 GAACACAGCTTCCTCAATAGGGG + Intronic
929033054 2:37666720-37666742 GAAAACTGCTTTTCTACCAGAGG + Intronic
929063481 2:37948079-37948101 GAACACAGCTACTCAAATTGTGG + Intronic
929379329 2:41331835-41331857 GAACATAGCTTCTCTAATAATGG - Intergenic
929459002 2:42087590-42087612 GAACACAGCTGCTCTATAAATGG + Intergenic
931941879 2:67261150-67261172 GAACACTGCTCCTCTGACTGGGG + Intergenic
932864308 2:75325422-75325444 GAACAGAGCATCTGTAAGAGAGG - Intergenic
934777430 2:96948411-96948433 GAACACAGGTCCTCAAACAAGGG + Intronic
935315289 2:101827478-101827500 GAACACAGCTTATCTGTCTGGGG - Intronic
935428358 2:102945095-102945117 GATCAAAGCTTCTCTCCCAGAGG + Intergenic
936660761 2:114541107-114541129 GAAAATAGCTTCTCTGGCAGGGG + Intronic
942133763 2:172905547-172905569 GGAGAGAGCATCTCTAACAGGGG + Intronic
942949772 2:181709152-181709174 AAACAGAGCTTCAGTAACAGGGG - Intergenic
944785758 2:203068432-203068454 TAAACCAGCTTCTCTCACAGTGG + Exonic
944981118 2:205121118-205121140 GTACAGATCTTCTCTAACATGGG - Intronic
945855566 2:215065669-215065691 GAAGACAGCTTTTCTTCCAGAGG + Intronic
946152289 2:217784853-217784875 GAACAGTGCTTCTCAACCAGAGG - Intergenic
948159146 2:235809928-235809950 GAACACAGCTACCATAACTGTGG - Intronic
1168857245 20:1017260-1017282 GACCAGTGCTTCTCAAACAGAGG - Intergenic
1170420075 20:16184094-16184116 CAGCTCAGCTTCTCTAACTGTGG + Intergenic
1171957868 20:31473744-31473766 GACCACAGATTCACTAACACTGG + Intronic
1172628903 20:36365314-36365336 GAACGCATCTTCTCAAACACCGG + Intronic
1173472906 20:43337452-43337474 GCACAAAGCTTCTGGAACAGGGG - Intergenic
1173686888 20:44930298-44930320 GAACACAGCTTAGTAAACAGGGG + Intronic
1175026463 20:55907698-55907720 GCACACAGCTTGGGTAACAGAGG + Intergenic
1177877889 21:26656740-26656762 CAACTCAGCTTCTATATCAGGGG + Intergenic
1178180957 21:30160812-30160834 GAAAAAATCTTCTCTTACAGAGG - Intergenic
1179329804 21:40388652-40388674 GAACACAGCTGGTTTATCAGTGG - Intronic
1179511776 21:41878697-41878719 GGACTCAGCTTCTCTAAACGCGG + Exonic
1179517386 21:41918026-41918048 GCACACAGATTCTCCAAGAGAGG + Intronic
1180004913 21:45015993-45016015 GAACACAGCATCCCTATGAGGGG + Intergenic
1183417809 22:37692556-37692578 CAACACAGCTCCTCTAACCAAGG - Exonic
1184269636 22:43371823-43371845 GAACGAAGCTTCTCTAACGTGGG + Intergenic
1184973731 22:48046200-48046222 GAATTCACCTTCTCTCACAGGGG + Intergenic
1185146106 22:49137509-49137531 GAATACCCCTCCTCTAACAGGGG + Intergenic
952122944 3:30266195-30266217 TAAGACAGCTTCTCTACCAGGGG + Intergenic
952752647 3:36837757-36837779 GAACACAGCTACTCACAGAGTGG - Intronic
955968480 3:64413225-64413247 AAACACAGGTTCTGTAACTGGGG - Intronic
956630025 3:71307493-71307515 AAACACAGGTTCTCTAAGCGGGG + Intronic
957721624 3:84009372-84009394 GATAACAGCTACTCTAACTGGGG + Intergenic
960711718 3:120537092-120537114 GATCACAGCTCTTCTATCAGAGG + Intergenic
963727522 3:148938833-148938855 TAACACAGCTTTTCCAACATTGG - Intergenic
967313365 3:188127575-188127597 GAACACTGTTTCTTTTACAGGGG + Intergenic
968015610 3:195329672-195329694 GGAAACAGCATCTCTCACAGAGG + Intronic
970451714 4:16173632-16173654 GAAGACATATTCTCTATCAGTGG - Intronic
973206545 4:47566882-47566904 AAACAAAGCTTATCTAACATGGG + Intronic
977236648 4:94515551-94515573 GAACAGAGTTTCTCTAAGTGTGG - Intronic
982135953 4:152274264-152274286 GAACAAAGCTTTCCTAATAGGGG + Intergenic
983511781 4:168616719-168616741 TAAATCAGCATCTCTAACAGTGG + Intronic
984103676 4:175517715-175517737 TAATACAGCTTCTATAACATGGG + Intergenic
984243971 4:177252435-177252457 GAACACGCCTTCAGTAACAGTGG + Intergenic
985729978 5:1541843-1541865 GAACACAGCATCTCCCTCAGCGG + Intergenic
991002241 5:61794142-61794164 GAAAACACCTTTTCTAAGAGGGG + Intergenic
991048071 5:62243824-62243846 AAACACAGTTTCTCTAATGGTGG - Intergenic
994759688 5:103836855-103836877 GAGTACAGCTTCTCTCCCAGAGG - Intergenic
1000340450 5:160273331-160273353 GAACACAGCTTCTCTAACAGAGG + Intronic
1003210763 6:4063820-4063842 GCATACAGCTACTCTAAAAGAGG - Intronic
1005112375 6:22296771-22296793 GAACAATGGTTCTCAAACAGGGG - Intronic
1005850053 6:29814395-29814417 GACCACAGCTGCCCTGACAGAGG + Intergenic
1008750004 6:54721315-54721337 GAACAAAGGTTCTCTAAGATAGG + Intergenic
1008789412 6:55211971-55211993 GCACAGGGCTTCTCTAAAAGTGG + Intronic
1010792854 6:80084773-80084795 GAACACTGGTTCTCAAAGAGGGG - Intergenic
1012751984 6:103175672-103175694 CATCACAGCTTCTGTAACAATGG + Intergenic
1013801640 6:113952188-113952210 GACCAGTGCTTCTCAAACAGTGG - Intronic
1017318532 6:153061016-153061038 GCACTTAGGTTCTCTAACAGAGG + Intronic
1018707109 6:166471055-166471077 GAACACAGCTTGCAGAACAGGGG - Intronic
1021898629 7:25261269-25261291 GCACACAGCTTGTGAAACAGAGG - Intergenic
1023032139 7:36099077-36099099 GACCACAGCTTCTCTAGTGGAGG - Intergenic
1023688486 7:42762239-42762261 GAGCACAACTCCTCTAACACGGG + Intergenic
1024169248 7:46767087-46767109 AAAAACAGCTTCTCTGAAAGTGG + Intergenic
1024407498 7:48999261-48999283 AAACACATCTTCATTAACAGGGG - Intergenic
1026212426 7:68317768-68317790 GAGCACAGCTTTACAAACAGAGG + Intergenic
1030712737 7:112770407-112770429 GAACAAATCTTAGCTAACAGAGG + Intronic
1032115220 7:129111077-129111099 GAATACAGCTTCTACAGCAGAGG + Intergenic
1034910239 7:154990901-154990923 GAAAATAGCTTCTCTAAAACTGG + Intronic
1036727238 8:11231067-11231089 GAACAGAGATTCTCTAATTGTGG + Intergenic
1037163215 8:15796974-15796996 GCAGACAGCTTCTCTACCAGAGG - Intergenic
1042793845 8:72638499-72638521 GAACCCAGCTTCTACAAAAGGGG - Intronic
1047876758 8:129146985-129147007 GAAGTCACTTTCTCTAACAGAGG + Intergenic
1048076519 8:131077522-131077544 TATCACAGCTTCTGTAGCAGAGG - Intergenic
1048733659 8:137473025-137473047 GGACAGAACTTCTCTACCAGTGG - Intergenic
1050469846 9:5975941-5975963 GAACAGAGCTTCCCTATCAGTGG + Intronic
1050482201 9:6098925-6098947 CAGCACAGCTTCCCTTACAGAGG + Intergenic
1052822969 9:33153913-33153935 GAACAGACCTTTTCTGACAGTGG + Intronic
1060715215 9:125920333-125920355 GAACTCACCTATTCTAACAGTGG - Intronic
1189760694 X:44318939-44318961 GAAGACAGATCCACTAACAGTGG + Intronic
1192326325 X:70135162-70135184 GAACAGAGCTCCTCAATCAGTGG - Intronic
1195105305 X:101597683-101597705 ACACAAAGCCTCTCTAACAGTGG - Intergenic
1195107577 X:101616084-101616106 ACACAAAGCCTCTCTAACAGTGG + Exonic
1196031588 X:111098991-111099013 CTACACAGCTTCTCCAGCAGGGG + Intronic
1196965509 X:121050373-121050395 GCACCCAGCTTCACTAACAGTGG + Intergenic
1198432489 X:136581335-136581357 GCACACAGCTTCTCTAGCCAGGG + Intergenic
1201943415 Y:19483770-19483792 ATACTCTGCTTCTCTAACAGAGG + Intergenic